Detail of EST/Unigene TCMT42481 |
Acc. | TCMT42481 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Inositol-3-phosphate synthase OS=Nicotiana paniculata E-value=0; Inositol-3-phosphate synthase OS=Nicotiana tabacum E-value=0; Inositol-3-phosphate synthase OS=Sesamum indicum E-value=0; Inositol-3-phosphate synthase OS=Triticum aestivum E-value=0; Inositol-3-phosphate synthase OS=Mesembryanthemum crystallinum E-value=0; |
Length | 1853 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought (19 ESTs); MT_GESD (7 ESTs); MtBA (7 ESTs); MT_DLEAF (7 ESTs); MT_FLOSEED_MTY (4 ESTs); MT_VILEAF (4 ESTs); MT_INSECT (4 ESTs); MT_DSLC (3 ESTs); MT_SEEDROOT_KV3 (3 ESTs); MT_DFLOWER (3 ESTs); MT_Shoots (2 ESTs); MT_DSTEM2 (2 ESTs); MT_SROOT_KV0 (2 ESTs); GLSD (2 ESTs); MT_GSEED (2 ESTs); MTPOSE (1 ESTs); MT_ECELL (1 ESTs); MT_HOGA (1 ESTs); MT_SROOT_KV1 (1 ESTs); MHRP-root (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_GPOD (1 ESTs); |
Sequence | ATCGATCGCAATTCTTTTACAGAGAAAGAAAGAAACAGAATCTTCCTTTTCATTTCTTTC |
EST members of Unigene | CX541079 CX538391 CX524584 CX523792 AW688506 AW696813 BF646101 DW018542 DW018483 DW016706 DW015375 BF005869 BF005778 BF005128 CA990751 CA918411 CA918410 BI311216 BI310232 BI309908 BI309765 BE240569 BG644808 AW774754 AW736490 BQ149386 BQ147801 BQ146870 BG454095 BG453128 BG453060 BG452864 BG452447 BG452059 AW683718 BI309379 AJ498066 BE204013 AI974505 CA989398 CA858784 CX523563 CX520004 CX517601 CX516519 BG646617 BE202433 AL370408 AL367859 AL367474 AL367473 AL366268 AL365771 AL365770 BG451785 BG450841 BG450652 BE248097 BE248640 BE248920 BE248725 BE248868 BF636324 BF635957 BF635182 BF634972 BF633649 BF633780 BF633473 BF632510 BF632416 BF631971 BF631921 BI266529 BI265956 BF641088 BE322894 EY476095 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01858 myo-inositol-1-phosphate synthase; Metabolism > Carbohydrate Metabolism > ko00562 Inositol phosphate metabolism > K01858 myo-inositol-1-phosphate synthase |
EC | 5.5.1.4 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.15285.1.S1_at, Mtr.32665.1.S1_s_at
|
Corresponding NCBI Gene | 816757 |
Trichome-related Gene from Literature | N/A |