Detail of EST/Unigene TCMT43290 |
Acc. | TCMT43290 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 60S ribosomal protein L21-1 OS=Arabidopsis thaliana E-value=4e-78; 60S ribosomal protein L21-2 OS=Arabidopsis thaliana E-value=9e-78; 60S ribosomal protein L21 OS=Cyanophora paradoxa E-value=9e-41; 60S ribosomal protein L21 OS=Dictyostelium discoideum E-value=1e-39; 60S ribosomal protein L21-A OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=2e-39; |
Length | 734 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED (5 ESTs); MT_JCVI-MT2 (5 ESTs); MT_DSIL (3 ESTs); MtBA (3 ESTs); MtBB_NOD (2 ESTs); MT_VILEAF (2 ESTs); MT_SROOT_KV1 (2 ESTs); MT_Shoots (2 ESTs); MTAMP (2 ESTs); MT_JCVI-MT3 (2 ESTs); MHRP-root (1 ESTs); MT_DLEAF (1 ESTs); MtBC_GLOMUS (1 ESTs); MT_PhoLEAF (1 ESTs); MT_DROOT (1 ESTs); MTFLOW (1 ESTs); MT_NOD_GVN (1 ESTs); MT_Drought (1 ESTs); MT_GESD (1 ESTs); |
Sequence | GGGATTTCATATCAGACAGTGAAGGGTTAGAAGAGGTTCGGCTGCGACGCAGAAACCCTA |
EST members of Unigene | AL389502 AL378789 AL378788 BE319688 CX541715 CX541236 CX540816 CX536671 BI268550 CX527073 CX523703 BG580148 AJ504100 AJ501702 BI311914 BG588723 AW683130 BF519383 BF518497 AW981375 BF637673 CX521163 CX519830 BF004034 BF003316 AJ497517 AL373413 AL373412 AL368951 BF632712 EY475989 EY476134 GE350628 GE347829 GE349023 GE343881 GE345711 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02889 large subunit ribosomal protein L21e |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.40176.1.S1_at
|
Corresponding NCBI Gene | 837497 |
Trichome-related Gene from Literature | N/A |