| Detail of EST/Unigene TCMT55717 |
| Acc. | TCMT55717 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Asparagine synthetase, nodule [glutamine-hydrolyzing] OS=Pisum sativum E-value=0; Asparagine synthetase [glutamine-hydrolyzing] 2 OS=Lotus japonicus E-value=0; Asparagine synthetase [glutamine-hydrolyzing] 1 OS=Lotus japonicus E-value=0; Asparagine synthetase, root [glutamine-hydrolyzing] OS=Pisum sativum E-value=0; Asparagine synthetase [glutamine-hydrolyzing] OS=Arabidopsis thaliana E-value=0; |
| Length | 2195 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_GVN (11 ESTs); MT_JAS_ROOR (10 ESTs); MT_MGHG (8 ESTs); MT_ROOTPHOS (8 ESTs); MHRP-root (5 ESTs); MT_NOD_NOLLY (4 ESTs); MtBC_GLOMUS (4 ESTs); MT_NOD_GVSN (4 ESTs); MTGIM (4 ESTs); MT_SIRRA (3 ESTs); MT_SEEDROOT_KV3 (2 ESTs); MtBB_NOD (2 ESTs); MT_DFLOWER (2 ESTs); MT_LEAF_PHOMA (2 ESTs); MT_Drought (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_CDS (2 ESTs); MT_BML (1 ESTs); MT_DROOT (1 ESTs); MT_GSEED (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_KVKC (1 ESTs); MT_NOD_ROOT (1 ESTs); |
| Sequence | GAACCATTCTACGTGTTGGTTATTCCACACTCTTTGCACCTTGTTTTTCGTGTCTTCTTC |
| EST members of Unigene | BT051094 BT050619 DY617575 DY617400 DY615990 DY615652 AL389424 AL388801 AL383283 AL383282 AL378128 AL378127 BE320357 CX539546 EV256974 BE998434 BE997478 BE997416 AW208128 BG583520 BG583158 BG583149 BG583141 BG582532 BG582027 BG580568 BG580367 BE124601 AW980902 AW980435 AW685063 AW329853 AW329557 AW329023 AW288049 AW287953 AW287917 AW126284 AW126211 AJ499851 AJ499807 AJ499414 AJ500533 BG588164 BE240579 BE239904 BE239569 BE239380 BG646178 AW773806 BI272920 BI270149 BQ139881 BQ138466 BQ156238 BQ155070 BI269268 CX535125 CX533954 CX533611 CX532260 CX532250 CX531750 CX531106 CX530491 CX530168 CX530058 BQ164953 BE943109 BE942312 BE942303 BE942166 BE941954 BE941289 BE941059 BE940913 BG450989 BF635940 GE347132 GE345672 GD185067 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01953 asparagine synthase (glutamine-hydrolysing); Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K01953 asparagine synthase (glutamine-hydrolysing) |
| EC | 6.3.5.4 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.8498.1.S1_at, Mtr.8498.1.S1_s_at
|
| Corresponding NCBI Gene | 823888 |
| Trichome-related Gene from Literature | N/A |