Detail of EST/Unigene TCMT55755 |
Acc. | TCMT55755 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S6 OS=Asparagus officinalis E-value=0; 40S ribosomal protein S6-2 OS=Arabidopsis thaliana E-value=0; 40S ribosomal protein S6-1 OS=Arabidopsis thaliana E-value=0; 40S ribosomal protein S6 OS=Rattus norvegicus E-value=2e-65; 40S ribosomal protein S6 OS=Mus musculus E-value=2e-65; |
Length | 1053 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED (6 ESTs); MT_GESD (5 ESTs); MtBB_NOD (5 ESTs); MT_SEEDROOT_KV3 (5 ESTs); MT_DFLOWER (3 ESTs); MT_ECELL (3 ESTs); MT_INSECT (2 ESTs); MT_DLEAF (2 ESTs); MT_NOD_ROOT (2 ESTs); MT_JAS_ROOR (2 ESTs); MT_CDS (1 ESTs); MT_SROOT_KV1 (1 ESTs); MT_NOD_NOLLY (1 ESTs); MHRP-root (1 ESTs); MT_Drought (1 ESTs); MT_DROOT (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_DSIL (1 ESTs); MT_JCVI-MT1 (1 ESTs); MtSNF (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_PhoLEAF (1 ESTs); MT_NOD_GVN (1 ESTs); MT_SIRRA (1 ESTs); MTAMP (1 ESTs); MT_HOGA (1 ESTs); |
Sequence | CTCACTCGCCGTATCGCGAACGAAGAAGCTGAGATCCAAATCAACATTTCACAATGAAGT |
EST members of Unigene | BT051915 DY615975 AL379020 AL379019 AL376563 AL376562 AL373474 BE320023 CX541238 CX538254 CX536364 CX536296 BI268667 BI268635 BF651048 BF650675 BF649103 EV257659 DW018767 BG581280 AW685605 AW684912 AJ503374 CA990476 BI312195 BI312135 BI312052 BI310658 BG589081 CB892075 BG645605 AW773801 AW736582 AW736581 BQ149091 BQ148262 BI272294 BG452456 AW682910 AW127508 AJ845892 BE324208 BI268955 CX533280 CX532626 CB065386 BE203218 BE248304 BI265588 BG449250 EY474941 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02991 small subunit ribosomal protein S6e; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K02991 small subunit ribosomal protein S6e |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1319.1.S1_at, Mtr.48856.1.S1_at
|
Corresponding NCBI Gene | 830900 |
Trichome-related Gene from Literature | N/A |