Detail of EST/Unigene TCMT55864 |
Acc. | TCMT55864 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | unknown |
Length | 988 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1 (7 ESTs); MT_SIRRA (3 ESTs); MT_CDS (2 ESTs); MT_DSIL (1 ESTs); MtBC_GLOMUS (1 ESTs); MT_SROOT_KV2 (1 ESTs); MT_GSEED (1 ESTs); GLSD (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_PhoLEAF (1 ESTs); MT_ECELL (1 ESTs); MT_SROOT_KV1 (1 ESTs); MT_NOD_GVN (1 ESTs); MTFLOW (1 ESTs); MTAMP (1 ESTs); MT_Drought (1 ESTs); MHRP-root (1 ESTs); MT_INSECT (1 ESTs); MT_DFLOWER (1 ESTs); MT_DLEAF (1 ESTs); MTUS_MIXTISSUE (1 ESTs); |
Sequence | TCCATTATTAATAAATATACAAACATATCCATTTTTACATTTTGGTGTCTATCTTCTTTT |
EST members of Unigene | BT051175 AF180292 CA922447 AL386815 CX542232 AW559774 BF649141 EV262312 EV262243 EV261558 EV260591 EV259222 EV255602 EV254939 BG583005 AJ503418 BG589018 BI272658 BG454740 BF518586 AW191205 BQ122332 BG456173 BQ156330 BQ154400 BQ153243 BF003917 AJ497231 BE247966 BE322028 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.18691.1.S1_s_at, Mtr.44333.1.S1_s_at
|
Corresponding NCBI Gene | 832254 |
Trichome-related Gene from Literature | N/A |