Detail of EST/Unigene TCMT58998 |
Acc. | TCMT58998 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Serine/threonine-protein kinase AtPK2/AtPK19 OS=Arabidopsis thaliana E-value=0; Serine/threonine-protein kinase AtPK1/AtPK6 OS=Arabidopsis thaliana E-value=0; Protein kinase 2 OS=Dictyostelium discoideum E-value=2e-84; Ribosomal protein S6 kinase beta-1 OS=Bos taurus E-value=9e-79; Ribosomal protein S6 kinase beta-1 OS=Rattus norvegicus E-value=2e-78; |
Length | 2043 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE (3 ESTs); MT_HOGA (3 ESTs); MT_SEEDROOT_KV3 (3 ESTs); MT_INSECT (3 ESTs); MT_SROOT_KV2 (2 ESTs); MT_NOD_GVN (2 ESTs); MT_Drought (2 ESTs); MT_DLEAF (1 ESTs); MT_GPOD (1 ESTs); MT_DSIL (1 ESTs); MtBC_GLOMUS (1 ESTs); MT_PhoLEAF (1 ESTs); MT_Shoots (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_NOD_GVSN (1 ESTs); MT_KVKC (1 ESTs); MT_LEAF_PHOMA (1 ESTs); |
Sequence | TTGATACATTTAGAGACTATAGTGACGGCGCCGCACAAATTCAGAGAAAATACTCGAAGC |
EST members of Unigene | CF068407 CA922357 CA919083 AL388887 CX528080 DW018116 BE999145 BE124599 AW981119 CB891277 CB891054 AW736157 BQ137977 BE249606 BI308723 BF519926 AW299205 AI974600 BE324882 CX531082 CB894073 CB065436 BG647184 BQ255281 BE249187 BF632561 BI267094 BI265243 BF641776 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04688 p70 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04688 p70 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04688 p70 ribosomal S6 kinase |
EC | 2.7.11.1 |
Transcription Factor Family | WRKY |
Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
Probeset |
Mtr.12378.1.S1_at
|
Corresponding NCBI Gene | 820019 |
Trichome-related Gene from Literature | N/A |