| Detail of EST/Unigene TCMT41067 |
| Acc. | TCMT41067 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S2-4 OS=Arabidopsis thaliana E-value=0; 40S ribosomal protein S2-3 OS=Arabidopsis thaliana E-value=0; 40S ribosomal protein S2-2 OS=Arabidopsis thaliana E-value=0; 40S ribosomal protein S2-1 OS=Arabidopsis thaliana E-value=0; 40S ribosomal protein S2 OS=Ictalurus punctatus E-value=1e-99; |
| Length | 1093 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA (12 ESTs); MT_DLEAF (10 ESTs); MT_GSEED (8 ESTs); MtBC_GLOMUS (5 ESTs); MT_GESD (4 ESTs); MT_DFLOWER (4 ESTs); MT_INSECT (3 ESTs); MT_TRI (3 ESTs); MT_ECELL (3 ESTs); MT_Drought (2 ESTs); MT_NOD_NOLLY (2 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_DSIL (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_Shoots (2 ESTs); MT_DSTEM2 (2 ESTs); MT_JAS_ROOR (2 ESTs); MT_HOGA (2 ESTs); MT_NOD_GVN (2 ESTs); MT_SROOT_KV0 (1 ESTs); GLSD (1 ESTs); MT_PhoLEAF (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MTFLOW (1 ESTs); MtRHE (1 ESTs); |
| Sequence | CATTTCTAGGGTTTCATCTCTTCTCTTCTCAGCGCCGCAGTTTTCTTCTTCTCTCTCTCT |
| EST members of Unigene | DY618285 DY617287 CA920347 CA918833 AL385986 AL385985 AL384834 AL384833 AL384443 CX541337 CX540407 CX540102 CX537026 CX536616 CX536139 BI268821 BI268774 CX526688 CX524542 AW697293 AW689825 BF644508 BF644304 BF643924 DW017402 BG582319 BG580166 BI311478 BI311126 BI310383 BI310081 BQ147621 BQ147220 BI272889 BI271237 BG453953 BG453936 BG453708 BG453691 BG453662 BG453082 BG453025 BG452394 BE316973 BF637159 BE123959 AW776904 AW225572 BQ122632 BF637463 CX531555 CX530922 BG648644 BG646604 AJ497961 AA660399 AL372193 AL372192 AL371895 AL371696 AL371695 AL370833 AL370832 AL370660 AL370659 AL368676 AL368675 AL366784 BF632982 BF631768 BI267441 BE321986 BF639568 GE348813 GE343629 EX532354 EX532353 ES612555 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02981 small subunit ribosomal protein S2e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.42992.1.S1_at
|
| Corresponding NCBI Gene | 824916 |
| Trichome-related Gene from Literature | N/A |