| Detail of EST/Unigene TCMT41299 |
| Acc. | TCMT41299 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Polyubiquitin 10 OS=Arabidopsis thaliana E-value=0; Polyubiquitin OS=Nicotiana sylvestris E-value=0; Polyubiquitin OS=Petroselinum crispum E-value=0; Polyubiquitin OS=Petroselinum crispum E-value=0; Polyubiquitin OS=Geodia cydonium E-value=0; |
| Length | 1649 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA (8 ESTs); MT_JAS_ROOR (7 ESTs); MT_DSTEM2 (6 ESTs); MtBC_GLOMUS (5 ESTs); MT_SEEDROOT_KV3 (4 ESTs); MT_INSECT (4 ESTs); MT_SROOT_KV1 (3 ESTs); MtBA (3 ESTs); MT_Drought (3 ESTs); MT_DSIL (3 ESTs); MT_DFLOWER (2 ESTs); MT_DLEAF (2 ESTs); MT_GPOD (2 ESTs); MT_SROOT_KV2 (2 ESTs); MT_PhoLEAF (2 ESTs); MT_ECELL (2 ESTs); MHRP-root (2 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_NOD_NOLLY (1 ESTs); MT_TRI (1 ESTs); MtBB_NOD (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_SIRRA (1 ESTs); MT_VILEAF (1 ESTs); |
| Sequence | AGATCCTAATCCGATATTCGAAAAACCTAAACTCTCTCTTTTCTTCTTCTTTCTATCTAC |
| EST members of Unigene | DY616103 AL386903 AL386902 AL383535 AL383534 AL383496 AL381232 AW693903 AW696004 BE325615 AW690386 AW689324 AW688083 BF650123 BF648821 BG588676 BE240793 CB892216 BG644968 BG644839 AW774408 BI270726 BI270101 BQ140426 BG454415 BE318597 CA917846 BI307967 BF521292 BF520993 BF520722 BM780224 BM780132 AI974382 BI263675 BG457613 BQ154061 CX516575 CX535049 CX535030 CX533067 CX531678 CX530787 CX529342 CX529189 CB894198 CB893798 CB893623 CB893487 CB893206 CB892691 BG649083 BG647952 BF004036 BE202897 BE202896 AL372558 AL372557 AL367435 BG450795 BF636261 BE249243 BI268130 BI265868 BF641657 BF639727 EX529694 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.37219.1.S1_at, Mtr.3816.1.S1_at, Mtr.8453.1.S1_s_at
|
| Corresponding NCBI Gene | 825880 |
| Trichome-related Gene from Literature | 825880 |