| Detail of EST/Unigene TCMT41449 |
| Acc. | TCMT41449 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 60S ribosomal protein L4-1 OS=Arabidopsis thaliana E-value=0; 60S ribosomal protein L4 OS=Prunus armeniaca E-value=0; 60S ribosomal protein L4-2 OS=Arabidopsis thaliana E-value=0; 60S ribosomal protein L4-A OS=Xenopus laevis E-value=0; 60S ribosomal protein L4-B OS=Xenopus laevis E-value=0; |
| Length | 1618 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2 (8 ESTs); MT_NOD_GVN (6 ESTs); MT_INSECT (5 ESTs); MtBA (4 ESTs); MtBC_GLOMUS (4 ESTs); MT_JAS_ROOR (4 ESTs); MTUS_MIXTISSUE (3 ESTs); MT_DFLOWER (3 ESTs); MTGIM (2 ESTs); MT_SEEDROOT_KV3 (2 ESTs); MtBB_NOD (2 ESTs); MT_JCVI-MT3 (2 ESTs); MT_SROOT_KV2 (2 ESTs); MT_SROOT_KV0 (2 ESTs); GLSD (2 ESTs); MT_SROOT_KV1 (1 ESTs); MTFLOW (1 ESTs); MT_NOD_NOLLY (1 ESTs); MT_Drought (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_DLEAF (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_Shoots (1 ESTs); MT_ECELL (1 ESTs); MT_PhoLEAF (1 ESTs); MT_DSLC (1 ESTs); |
| Sequence | TGATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCG |
| EST members of Unigene | DY616836 CF069547 CA919994 CA919167 AL383504 AL383503 AL383279 AL383278 AL376622 AL376621 AW560848 CX523666 BQ137092 BE325684 AW690737 AW692172 AW693543 AW690746 AW689725 AW689485 BF645596 BG583312 BG582619 BG581979 BG580447 BE124487 AW127295 BF006603 AJ499251 AJ500430 CB892443 BG645489 BQ147029 BQ146896 BI271746 BQ139992 BG453776 BM779976 BM779787 BE205187 BE203647 BQ123393 BQ122637 BE324803 CX535072 CX534442 CX533580 CX529175 BE202599 AJ497347 AL370550 AL370549 AL370299 AL366151 BF634854 BI266840 BI265386 BG448960 BE322663 BF640373 EY475992 EY475173 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02930 large subunit ribosomal protein L4e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.43002.1.S1_at
|
| Corresponding NCBI Gene | 820120 |
| Trichome-related Gene from Literature | N/A |