| Detail of EST/Unigene TCMT41980 |
| Acc. | TCMT41980 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 60S ribosomal protein L37-3 OS=Arabidopsis thaliana E-value=4e-43; 60S ribosomal protein L37-2 OS=Arabidopsis thaliana E-value=7e-43; 60S ribosomal protein L37-1 OS=Arabidopsis thaliana E-value=7e-42; Probable 60S ribosomal protein L37-A OS=Drosophila melanogaster E-value=3e-32; 60S ribosomal protein L37 OS=Ictalurus punctatus E-value=1e-30; |
| Length | 824 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD (5 ESTs); MT_JCVI-MT2 (4 ESTs); MtBC_GLOMUS (3 ESTs); MT_ECELL (3 ESTs); MT_ROOTPHOS (2 ESTs); MT_NOD_NOLLY (2 ESTs); MT_DLEAF (2 ESTs); MT_JCVI-MT3 (1 ESTs); MT_CDS (1 ESTs); MHRP-root (1 ESTs); MT_TRI (1 ESTs); MT_DFLOWER (1 ESTs); GLSD (1 ESTs); MT_GSEED (1 ESTs); MT_PhoLEAF (1 ESTs); MT_DSTEM2 (1 ESTs); MT_SIRRA (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_JCVI-MT1 (1 ESTs); MtBA (1 ESTs); MT_NOD_GVSN (1 ESTs); MT_MGHG (1 ESTs); MT_NOD_GVN (1 ESTs); |
| Sequence | TGATTCGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
| EST members of Unigene | BT051166 DY616054 DY615991 AL389697 AL381610 AL381609 AL380907 AL377326 AL375270 AL374544 AL374543 CX541679 AW692450 BQ136005 BF646022 BF644996 EV254763 AW208158 BG582636 AW329195 AW287915 BG588960 BQ146266 BG453099 AW682891 BQ124636 BG456370 BQ152050 CX531661 AL369871 BE942242 EY474670 GE350500 GE350859 GE345563 GE345971 EX530398 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02922 large subunit ribosomal protein L37e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.12436.1.S1_at
|
| Corresponding NCBI Gene | 820853 |
| Trichome-related Gene from Literature | N/A |