| Detail of EST/Unigene TCMT42125 |
| Acc. | TCMT42125 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Carbamoyl-phosphate synthase small chain OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=0; Carbamoyl-phosphate synthase small chain OS=Pelobacter carbinolicus (strain DSM 2380 / Gra Bd 1) E-value=0; Carbamoyl-phosphate synthase small chain OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=0; Carbamoyl-phosphate synthase small chain OS=Teredinibacter turnerae (strain ATCC 39867 / T7901) E-value=0; Carbamoyl-phosphate synthase small chain OS=Synechococcus elongatus (strain PCC 7942) E-value=0; |
| Length | 1869 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DLEAF (2 ESTs); MT_SROOT_KV0 (2 ESTs); MT_CDS (2 ESTs); MT_Drought (2 ESTs); MT_INSECT (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_DSLC (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_DFLOWER (1 ESTs); MT_SROOT_KV2 (1 ESTs); MT_PhoLEAF (1 ESTs); MT_GSEED (1 ESTs); MT_Shoots (1 ESTs); MT_NOD_GVN (1 ESTs); |
| Sequence | GGAACCAGCCCCACCCCGCGCTTCTTCTGTTAATCACCGAATCCTCTGTTAATCACCCCA |
| EST members of Unigene | BT052561 BT051601 CX539690 CX523965 EV261425 EV255018 BG581565 BF005367 BG645015 BQ147737 BG454818 BG452574 AW256697 BE204992 BE204900 BE324521 BF636388 BF631882 BG449315 BG448816 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase |
| EC | 2.1.3.2 3.5.2.3 6.3.4.16 6.3.5.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.28750.1.S1_s_at, Mtr.43247.1.S1_s_at
|
| Corresponding NCBI Gene | 822396 |
| Trichome-related Gene from Literature | N/A |