| Detail of EST/Unigene TCMT42533 |
| Acc. | TCMT42533 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 60S ribosomal protein L18a OS=Castanea sativa E-value=5e-91; 60S ribosomal protein L18a-2 OS=Arabidopsis thaliana E-value=7e-91; 60S ribosomal protein L18a-3 OS=Arabidopsis thaliana E-value=2e-89; 60S ribosomal protein L18a OS=Oryza sativa subsp. japonica E-value=4e-88; 60S ribosomal protein L18a OS=Dictyostelium discoideum E-value=3e-49; |
| Length | 1180 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2 (4 ESTs); MT_Drought (3 ESTs); MT_DFLOWER (3 ESTs); MT_GSEED (3 ESTs); MT_SIRRA (3 ESTs); MT_JCVI-MT1 (3 ESTs); MT_GESD (2 ESTs); MT_NOD_NOLLY (2 ESTs); MtBB_NOD (2 ESTs); MT_DSIL (2 ESTs); GLSD (2 ESTs); MT_JAS_ROOR (1 ESTs); MT_ROOTPHOS (1 ESTs); MT_SROOT_KV1 (1 ESTs); MT_CDS (1 ESTs); MtRHE (1 ESTs); MHRP-root (1 ESTs); MtBC_GLOMUS (1 ESTs); MT_DLEAF (1 ESTs); MT_DROOT (1 ESTs); MTPOSE (1 ESTs); MT_DSTEM2 (1 ESTs); MT_ECELL (1 ESTs); MT_VILEAF (1 ESTs); MT_UV-B (1 ESTs); |
| Sequence | TATAAGCCCCATAGGCTTTGCCAAACACATCCCTCAAAATGGTCAGAAACCTTGGTGGCA |
| EST members of Unigene | BT052190 DY618105 DY616125 AL382519 AL379469 AL379045 AW687859 CX541830 CX540171 CX538811 BE326182 BF648831 EV259478 EV258726 EV257975 DY632602 AW329331 CA991202 BI312228 BE240233 BQ149766 BQ147419 BI272285 BG454837 BF520301 AW776139 AJ498799 CA989820 BQ124387 BQ156364 BQ153188 BQ152990 CX521840 CX533488 BF004178 AA660169 BF632914 BF632790 BE248961 GE352187 GE347839 GE349832 GE344793 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02882 large subunit ribosomal protein L18Ae |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.2969.1.S1_at, Mtr.10362.1.S1_at
|
| Corresponding NCBI Gene | 818011 |
| Trichome-related Gene from Literature | N/A |