Detail of EST/Unigene TCMT42749 |
Acc. | TCMT42749 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S18 OS=Arabidopsis thaliana E-value=6e-68; 40S ribosomal protein S18 OS=Branchiostoma belcheri E-value=2e-56; 40S ribosomal protein S18 OS=Aequipecten irradians E-value=2e-56; 40S ribosomal protein S18 OS=Danio rerio E-value=1e-54; 40S ribosomal protein S18 OS=Ictalurus punctatus E-value=4e-54; |
Length | 827 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER (7 ESTs); MT_DLEAF (5 ESTs); MT_JCVI-MT2 (4 ESTs); MHRP-root (4 ESTs); MtBB_NOD (3 ESTs); MT_VILEAF (3 ESTs); MTFLOW (3 ESTs); MT_GPOD (2 ESTs); MT_JCVI-MT3 (2 ESTs); MT_GSEED (2 ESTs); MT_DSTEM2 (2 ESTs); MT_PhoLEAF (2 ESTs); MtBC_GLOMUS (2 ESTs); MT_Drought (1 ESTs); MT_INSECT (1 ESTs); MT_DROOT (1 ESTs); MT_DSIL (1 ESTs); MTPOSE (1 ESTs); MT_ECELL (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_SIRRA (1 ESTs); MT_ROOTPHOS (1 ESTs); MTAMP (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_GESD (1 ESTs); MT_CDS (1 ESTs); MT_MGHG (1 ESTs); |
Sequence | GGAACTCAAACATCACACAAGAAAGCAGAAGAGTTCAGATCTTCGCCGCCGCCTACCTCC |
EST members of Unigene | BT051386 AL387200 AL387199 AL375059 AL375058 AL374698 BE319411 CX541304 CX538598 AW696018 AW697345 BF650021 EV257393 AW288024 AJ501049 BI311624 BG589070 BG588251 BE240196 BE240191 BQ149771 BQ148518 BQ146465 BQ146464 BQ146463 BI270475 BI270385 BE316609 BE318950 AW683207 BE316466 BE318720 CA917227 CA916910 AW776810 AJ498230 BG457443 BE323046 BQ154243 CX521538 CX518354 CX517432 CX533215 AJ497786 AJ497408 AJ497374 BE941076 BG451618 BI267045 EY477391 EY475360 GE350403 GE348693 GE345448 GE343482 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02964 small subunit ribosomal protein S18e |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.12294.1.S1_at
|
Corresponding NCBI Gene | 826569 |
Trichome-related Gene from Literature | N/A |