| Detail of EST/Unigene TCMT46425 |
| Acc. | TCMT46425 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Nascent polypeptide-associated complex subunit alpha-like protein 2 OS=Arabidopsis thaliana E-value=8e-44; Nascent polypeptide-associated complex subunit alpha-like protein 4 OS=Arabidopsis thaliana E-value=2e-41; Nascent polypeptide-associated complex subunit alpha-like protein 3 OS=Arabidopsis thaliana E-value=3e-39; Nascent polypeptide-associated complex subunit alpha-like protein 1 OS=Arabidopsis thaliana E-value=2e-38; Nascent polypeptide-associated complex subunit alpha-like protein 5 OS=Arabidopsis thaliana E-value=7e-38; |
| Length | 1182 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA (4 ESTs); MT_INSECT (4 ESTs); MT_Drought (3 ESTs); MT_PhoLEAF (3 ESTs); MT_DFLOWER (2 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_DLEAF (2 ESTs); MT_DSIL (2 ESTs); MtBB_NOD (2 ESTs); MT_SROOT_KV2 (2 ESTs); MT_SROOT_KV0 (2 ESTs); MT_DSTEM2 (2 ESTs); MT_VILEAF (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_HOGA (1 ESTs); MTAMP (1 ESTs); MT_KVKC (1 ESTs); MT_GESD (1 ESTs); MT_CDS (1 ESTs); MT_MGHG (1 ESTs); MtBC_GLOMUS (1 ESTs); MT_BML (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_Shoots (1 ESTs); MT_JAS_ROOR (1 ESTs); |
| Sequence | CTAGAGTGTTGTTATCTCTTTCTCTATCTAATCCATCTTTTCTGTACTCATCACTTCACA |
| EST members of Unigene | BT053437 CF068218 CA918859 AL388625 AL378209 AL378208 AW559515 CX525641 AW691448 AW689675 EV261706 EV261507 DW017403 AJ502062 BI310944 BQ147245 BI273120 BE317343 BE317112 BF519856 BE124094 BM779827 AI974611 AI737555 AI737554 BG455598 BE323722 BE324831 CX522124 CX518426 CX534083 CB894435 BQ255230 AL367590 AL367589 AL365895 AL365894 BE942693 BG450328 BE248866 BF635431 BI265167 BE322842 BE322785 BE321688 GD185614 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.14807.1.S1_at
|
| Corresponding NCBI Gene | 824109 |
| Trichome-related Gene from Literature | N/A |