| Detail of EST/Unigene TCMT52759 |
| Acc. | TCMT52759 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 60S ribosomal protein L35 OS=Euphorbia esula E-value=2e-45; 60S ribosomal protein L35-4 OS=Arabidopsis thaliana E-value=4e-45; 60S ribosomal protein L35-2 OS=Arabidopsis thaliana E-value=6e-45; 60S ribosomal protein L35-1 OS=Arabidopsis thaliana E-value=3e-44; 60S ribosomal protein L35-3 OS=Arabidopsis thaliana E-value=3e-43; |
| Length | 724 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS (4 ESTs); MtBB_NOD (4 ESTs); MT_JCVI-MT2 (4 ESTs); MT_GSEED (3 ESTs); MT_NOD_NOLLY (2 ESTs); MT_DFLOWER (1 ESTs); MT_CDS (1 ESTs); MT_DSIL (1 ESTs); MTPOSE (1 ESTs); MT_SROOT_KV1 (1 ESTs); MT_INSECT (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_TRI (1 ESTs); MT_NOD_GVSN (1 ESTs); MTAMP (1 ESTs); MT_GESD (1 ESTs); |
| Sequence | GGTGTAGAAACCATAACAAAGCTTCCACATTCTACCAAGTTTTCTCGCGGCGATTCAAGA |
| EST members of Unigene | BT053501 DY618037 DY616366 AL384679 AL384678 AL382775 AL382774 AL380446 AL380445 AL375233 AL375232 CX541289 CX540277 CX539217 AW559750 EV262218 AW208300 AJ502176 BI312244 BI270334 BF521378 AJ499126 BF003999 BQ141641 EY476640 GE351891 GE347501 GE349442 GE344356 EX532384 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02918 large subunit ribosomal protein L35e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.21214.1.S1_at
|
| Corresponding NCBI Gene | 818524 |
| Trichome-related Gene from Literature | N/A |