Detail of EST/Unigene TCMT40201 |
Acc. | TCMT40201 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Secretory carrier-associated membrane protein OS=Pisum sativum E-value=0; Secretory carrier-associated membrane protein 3 OS=Arabidopsis thaliana E-value=0; Secretory carrier-associated membrane protein 2 OS=Oryza sativa subsp. japonica E-value=0; Secretory carrier-associated membrane protein 5 OS=Arabidopsis thaliana E-value=1e-98; Secretory carrier-associated membrane protein 1 OS=Arabidopsis thaliana E-value=2e-98; |
Length | 1354 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA (10 ESTs); MT_JCVI-MT1 (5 ESTs); MT_DSIL (4 ESTs); MT_SIRRA (4 ESTs); MT_JCVI-MT2 (3 ESTs); MT_SROOT_KV1 (2 ESTs); MT_SEEDROOT_KV3 (2 ESTs); MT_DFLOWER (2 ESTs); MtBB_NOD (2 ESTs); MT_Shoots (2 ESTs); MT_PhoLEAF (2 ESTs); MT_JAS_ROOR (1 ESTs); MT_NOD_GVSN (1 ESTs); MT_HOGA (1 ESTs); MT_CDS (1 ESTs); MT_NOD_GVN (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MtBC_GLOMUS (1 ESTs); MT_Drought (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_DROOT (1 ESTs); MT_DLEAF (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_GPOD (1 ESTs); MT_DSTEM2 (1 ESTs); MT_ECELL (1 ESTs); |
Sequence | AAAGGACCCTTCCTCTGTCGTAAAGTCTAAACTCCAAAGATAAATAAATAAAACTGCTCC |
EST members of Unigene | BT051947 CF069926 AL384720 AL374361 AL374360 BE320275 AW560676 CX526593 CX524411 AW694559 BF645342 EV260235 EV257300 EV256843 EV255264 EV255228 AW208099 AW980328 CB891710 BG645153 BI272334 BI271050 BQ139335 BG454817 BI308469 BF520134 BF518683 BE124167 AW775718 BG457294 BF638532 BQ156558 BQ156363 BI269345 BI269050 CX529907 CB893739 BF003965 BE203404 AL372838 AL371887 AL371886 AL371717 AL371716 AL371119 AL368183 AL365887 AL365886 AL365831 BG450807 GE351068 GE346284 GE346283 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.7.12.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.8536.1.S1_at, Mtr.8537.1.S1_s_at
|
Corresponding NCBI Gene | 842418 |
Trichome-related Gene from Literature | N/A |