| Detail of EST/Unigene TCMT40380 |
| Acc. | TCMT40380 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 60S ribosomal protein L17-2 OS=Arabidopsis thaliana E-value=4e-85; 60S ribosomal protein L17-1 OS=Arabidopsis thaliana E-value=1e-84; 60S ribosomal protein L17 OS=Zea mays E-value=2e-81; 60S ribosomal protein L17-1 OS=Hordeum vulgare E-value=3e-80; 60S ribosomal protein L17-2 OS=Hordeum vulgare E-value=8e-79; |
| Length | 826 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD (13 ESTs); MT_DLEAF (8 ESTs); MT_JCVI-MT2 (7 ESTs); MT_JCVI-MT1 (6 ESTs); MT_JCVI-MT3 (5 ESTs); MT_GSEED (5 ESTs); MT_ECELL (4 ESTs); MT_ROOTPHOS (3 ESTs); MT_GESD (3 ESTs); MT_FLOSEED_MTY (2 ESTs); MT_SIRRA (2 ESTs); MT_SROOT_KV1 (1 ESTs); MT_NOD_ROOT (1 ESTs); MT_MGHG (1 ESTs); MT_Drought (1 ESTs); MTAMP (1 ESTs); MtBC_GLOMUS (1 ESTs); MT_TRI (1 ESTs); MTPOSE (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_DSTEM2 (1 ESTs); MT_VILEAF (1 ESTs); MT_JAS_ROOR (1 ESTs); |
| Sequence | CCCTAATCTGCTGAATCTTCTCAGCCTCCTTCCCACAATCGTGTTCATTCCTAACGAATT |
| EST members of Unigene | AL389088 AL380914 AL380913 AL378231 AL378230 AL377509 AL377508 AL376742 AL376741 AL375489 AL375488 AL375298 AL375297 AL374761 CX541790 CX537856 CX536246 CX536078 BI268458 AW267920 AW696370 BQ135902 BF648195 BF647867 BF644793 EV261962 EV260766 EV259630 EV259309 EV257742 EV256420 DW016869 DW016102 AW686491 AW329300 AW126151 AW126064 AJ501519 CA990103 BI311588 BI311250 BG454811 BG454434 BE249488 BE316534 BE317708 AW683277 BF637010 BF636712 AJ498332 BE204578 BQ157324 BQ154062 CX522593 CX532856 BF003606 BE943001 BE248667 EY477463 EY476591 EY477892 EY474422 EY474263 GE351225 GE350679 GE344445 GE345149 GE346652 GE346651 GE345773 EX529030 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02880 large subunit ribosomal protein L17e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.40065.1.S1_at
|
| Corresponding NCBI Gene | 843063 |
| Trichome-related Gene from Literature | N/A |