Detail of EST/Unigene TCMT40907 |
Acc. | TCMT40907 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 2-Cys peroxiredoxin BAS1-like, chloroplastic OS=Arabidopsis thaliana E-value=0; 2-Cys peroxiredoxin BAS1, chloroplastic OS=Arabidopsis thaliana E-value=0; 2-Cys peroxiredoxin BAS1, chloroplastic OS=Spinacia oleracea E-value=0; 2-Cys peroxiredoxin BAS1, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-99; 2-Cys peroxiredoxin BAS1, chloroplastic (Fragment) OS=Hordeum vulgare E-value=5e-98; |
Length | 1121 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (9 ESTs); MT_INSECT (5 ESTs); MT_DSIL (3 ESTs); MT_PhoLEAF (3 ESTs); MT_VILEAF (3 ESTs); MT_TRI (3 ESTs); MT_GPOD (2 ESTs); GLSD (2 ESTs); MT_Shoots (2 ESTs); MT_SIRRA (2 ESTs); MT_DSTEM2 (2 ESTs); MtBA (2 ESTs); MT_GSEED (1 ESTs); MT_ECELL (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_NOD_GVSN (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_DFLOWER (1 ESTs); |
Sequence | CTTCCACCTCACAGGCTCACACTCACTCAAACATGGCCTGCTGCTCAGCTCCATCTGCTT |
EST members of Unigene | CX538435 CX527971 CX525520 BE326074 AW688097 BF643631 EV262097 BE999620 BQ149589 BG452973 BG452524 BE317956 AW682961 BE315907 BE319052 AW682877 BE316671 BE318025 BI309551 BI308800 BF521067 BF519094 AW981378 BQ124929 BQ124919 BI264435 BI264353 BG458174 BQ154857 BQ154585 CX523545 CX522996 CX517992 AL370096 AL370095 BI266250 BI266053 BG448905 BF641830 BF639644 EY478671 EX532073 EX528718 EX526366 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.11.1.15 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1080.1.S1_at, Mtr.25633.1.S1_at
|
Corresponding NCBI Gene | 830517 |
Trichome-related Gene from Literature | N/A |