| Detail of EST/Unigene TCMT40966 |
| Acc. | TCMT40966 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP29.3, chloroplastic OS=Arabidopsis thaliana E-value=0; Chlorophyll a-b binding protein CP29.1, chloroplastic OS=Arabidopsis thaliana E-value=6e-98; Chlorophyll a-b binding protein CP29.2, chloroplastic OS=Arabidopsis thaliana E-value=8e-97; Chlorophyll a-b binding protein CP29 OS=Chlamydomonas reinhardtii E-value=5e-64; Chlorophyll a-b binding protein 6, chloroplastic OS=Arabidopsis thaliana E-value=9e-27; |
| Length | 1163 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF (26 ESTs); MT_SIRRA (12 ESTs); MT_DSIL (11 ESTs); MT_PhoLEAF (11 ESTs); MT_DLEAF (10 ESTs); MT_INSECT (6 ESTs); MT_Drought (5 ESTs); MT_JCVI-MT1 (4 ESTs); MT_DSLC (4 ESTs); MT_DFLOWER (4 ESTs); MTUS_MIXTISSUE (3 ESTs); MT_DSTEM2 (3 ESTs); MT_Shoots (2 ESTs); MT_JCVI-MT2 (1 ESTs); MT_GESD (1 ESTs); MT_TRI (1 ESTs); MT_LEAF_PHOMA (1 ESTs); |
| Sequence | GCACGNTGGCAAGATAGACCACTCCCTTCTTGATCACTAAAACACATATATAATTCATTT |
| EST members of Unigene | CF067953 CF067946 CA918683 CX527673 CX526125 BE325223 AW692376 AW689043 EV259266 EV259052 EV257715 EV254908 BF006592 BF006420 BF006280 BF006125 CA990242 BQ147447 BI273237 BI272792 BI269993 BQ138910 BG454965 BG453828 BG453266 BG452877 BG452697 BG452077 AW683189 BE317658 BE249505 BE318235 BF521457 BF520638 BF519255 BF519139 BE124302 BE124242 AW776811 AW775867 AW775859 AW775494 AW775398 BI263632 BG458073 BG457698 BG457527 BG457157 BG457156 BG456715 BG455105 BE323916 BE323351 BF637844 BQ157707 BQ156859 BQ156618 BQ156501 BQ155472 BQ155417 BQ154376 BQ153745 BQ153492 BQ153056 BQ153033 BQ152809 CX523378 CX523303 CX523214 CX522753 CX522738 CX522627 CX522233 CX522154 CX522127 CX521501 CX521378 CX521309 CX521093 CX520951 CX519516 CX519222 CX519016 CX518968 CX518965 CX518494 CX518341 CX517793 CX517595 CX517520 CX517259 CX516740 BG451111 BG450513 BE248858 BF636031 BF634269 BI267722 BE321798 BE322115 BE322835 BF641796 BF640156 GE343361 ES610932 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1640.1.S1_at, Mtr.37361.1.S1_at
|
| Corresponding NCBI Gene | 818599 |
| Trichome-related Gene from Literature | N/A |