Detail of EST/Unigene TCMT41331 |
Acc. | TCMT41331 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit V, chloroplastic OS=Arabidopsis thaliana E-value=3e-55; Photosystem I reaction center subunit V, chloroplastic OS=Spinacia oleracea E-value=5e-48; Photosystem I reaction center subunit V, chloroplastic OS=Hordeum vulgare E-value=3e-42; Photosystem I reaction center subunit V, chloroplastic OS=Tortula ruralis E-value=3e-22; Photosystem I reaction center subunit V (Fragment) OS=Pisum sativum E-value=3e-14; |
Length | 778 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF (17 ESTs); MT_PhoLEAF (11 ESTs); MT_DSIL (8 ESTs); MT_JCVI-MT2 (6 ESTs); MT_DLEAF (6 ESTs); MT_INSECT (4 ESTs); MT_GESD (4 ESTs); MT_DFLOWER (3 ESTs); MT_SIRRA (3 ESTs); MT_DSLC (2 ESTs); MT_Drought (2 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_BML (1 ESTs); MT_TRI (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_GSEED (1 ESTs); MT_Shoots (1 ESTs); MT_DSTEM2 (1 ESTs); |
Sequence | GATTTCATATATCTACCTACTCTTCCATAATTCACTCATCATAGTAATCTTTCTTCAAAC |
EST members of Unigene | CX536967 CX527954 AW691255 DW016111 AW127705 AW127645 CA991252 CA990498 BI311139 BI310675 BQ149741 BQ149730 BQ146995 BQ137999 BE249764 BE317923 BE316783 BE249798 BE317784 BE319103 BF521414 BF520459 BF519226 BF518542 AW981481 AW127324 AW776502 AW775516 BI264339 BG457991 BG457171 BG456031 BG455545 BE323450 BE323696 BE324019 BE323814 BF639155 BF638694 BQ156287 BQ153519 BQ152989 CX523401 CX522566 CX522375 CX522369 CX521389 CX520504 CX520224 CX520131 CX519892 CX519438 CX519321 CX519035 CX518846 CX518518 CX518447 CX516773 CX516682 BG449955 BF632447 BI267317 BI266191 BE322972 BE322175 GE352322 GE347317 GE349519 GE347991 GE344446 GE344393 GD185165 ES612908 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.40230.1.S1_at
|
Corresponding NCBI Gene | 842016 |
Trichome-related Gene from Literature | N/A |