Detail of EST/Unigene TCMT41951 |
Acc. | TCMT41951 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-galactosidase OS=Escherichia coli O127:H6 (strain E2348/69 / EPEC) E-value=8e-17; Beta-galactosidase OS=Shigella sonnei (strain Ss046) E-value=1e-16; Beta-galactosidase OS=Escherichia coli (strain UTI89 / UPEC) E-value=1e-16; Beta-galactosidase OS=Escherichia coli E-value=1e-16; Beta-galactosidase OS=Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC) E-value=1e-16; |
Length | 776 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED (9 ESTs); MtBC_GLOMUS (9 ESTs); MT_SIRRA (8 ESTs); MT_PhoLEAF (7 ESTs); MT_DLEAF (5 ESTs); MTPOSE (4 ESTs); MT_UV-B (4 ESTs); MT_VILEAF (3 ESTs); MT_ROOTPHOS (3 ESTs); MtBB_NOD (2 ESTs); MT_Drought (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_DFLOWER (2 ESTs); MT_Shoots (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_DSLC (1 ESTs); MT_MGHG (1 ESTs); MT_JCVI-MT3 (1 ESTs); MTAMP (1 ESTs); MT_NOD_NOLLY (1 ESTs); MHRP-root (1 ESTs); |
Sequence | CTGATACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
EST members of Unigene | DY615610 AL389101 AL389100 AL386973 AL384970 AL384969 AL383727 AL382208 AL382207 AL381824 AL375576 AL375575 CX542220 CX540922 CX539183 CX537262 CX537248 CX536135 BQ146121 BQ146109 BI268423 CX525155 EV262266 DW015117 AW777047 DY633274 DY633156 DY632841 DY632786 AW329770 AW328830 AW287850 AJ502129 BE240413 BQ147044 BI270830 BQ151202 BG453091 BE319214 BE316668 BE316420 AJ499083 AJ498924 AJ498801 AJ498611 BQ157895 BI263317 BG456811 BG456660 BG456176 BG455365 BE323526 BQ157700 BQ156459 BQ156434 BQ154992 BQ154311 BQ154145 BQ152845 BQ152591 CX523163 CX518420 CX516657 BE943291 BF635071 BF633718 EY478367 GE350779 GE345883 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
AFFX-Mtr-gapc-3_s_at, Mtr.10365.1.S1_s_at
|
Corresponding NCBI Gene | 820771 |
Trichome-related Gene from Literature | 820771 |