Detail of EST/Unigene TCMT42048 |
Acc. | TCMT42048 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ubiquitin-like protein 5 OS=Arabidopsis thaliana E-value=5e-34; Ubiquitin-like protein 5 OS=Psammomys obesus E-value=6e-30; Ubiquitin-like protein 5 OS=Mus musculus E-value=6e-30; Ubiquitin-like protein 5 OS=Mesocricetus auratus E-value=6e-30; Ubiquitin-like protein 5 OS=Homo sapiens E-value=6e-30; |
Length | 795 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (5 ESTs); MT_GSEED (4 ESTs); MT_JCVI-MT2 (3 ESTs); MHRP-root (2 ESTs); MTPOSE (2 ESTs); MT_NOD_GVSN (2 ESTs); MT_Drought (2 ESTs); MT_NOD_GVN (1 ESTs); MT_TRI (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_DFLOWER (1 ESTs); MT_NOD_NOLLY (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_DSIL (1 ESTs); MtBC_GLOMUS (1 ESTs); MT_PhoLEAF (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_VILEAF (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_MGHG (1 ESTs); |
Sequence | CTGATTCGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
EST members of Unigene | DY618126 CF069897 AL387156 CX541136 CX539705 CX538566 CX537234 AW560159 EV260323 BE999550 BE998129 BG580199 BG589111 BG588492 CB892109 BI270575 BG453972 BG452334 BE317315 BE317268 BE318580 AW127403 AJ498834 AJ498462 BQ157927 CX519299 BE942702 BG450103 BF632086 GE351279 GE346771 GE346770 EX530621 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.2964.1.S1_at, Mtr.20631.1.S1_at
|
Corresponding NCBI Gene | 834235 |
Trichome-related Gene from Literature | N/A |