Detail of EST/Unigene TCMT42122 |
Acc. | TCMT42122 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 60S ribosomal protein L10a-2 OS=Arabidopsis thaliana E-value=2e-94; 60S ribosomal protein L10a-1 OS=Arabidopsis thaliana E-value=2e-94; 60S ribosomal protein L10a-3 OS=Arabidopsis thaliana E-value=5e-93; 60S ribosomal protein L10a-2 OS=Drosophila melanogaster E-value=9e-69; 60S ribosomal protein L10a OS=Xenopus laevis E-value=1e-67; |
Length | 1133 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2 (4 ESTs); MT_DFLOWER (3 ESTs); MT_INSECT (3 ESTs); MT_CDS (3 ESTs); MtBC_GLOMUS (3 ESTs); GLSD (3 ESTs); MtBB_NOD (3 ESTs); MT_JCVI-MT1 (3 ESTs); MTFLOW (3 ESTs); MtBA (3 ESTs); MT_Drought (2 ESTs); MT_GPOD (2 ESTs); MT_NOD_NOLLY (2 ESTs); MT_ECELL (2 ESTs); MT_GESD (2 ESTs); MHRP-root (1 ESTs); MT_DSIL (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MTPOSE (1 ESTs); MT_VILEAF (1 ESTs); MT_GSEED (1 ESTs); MT_HOGA (1 ESTs); MT_SROOT_KV1 (1 ESTs); |
Sequence | GATGCGCATTGCTCTCATTTCTTTCGTGCGGCTTCATCCTCTTCCTCCCTCCACTCTAAG |
EST members of Unigene | BT050718 BT053233 BT051527 DY617704 DY617697 CA922920 AL381974 AL381973 AL381317 AL376833 AL375762 AL375761 CX538738 BI262771 BF648001 EV261677 EV259330 EV259066 CA918593 BI310620 BG588578 BI272178 BI271955 BI271287 BI309397 BI308003 AW776876 AJ498144 BQ124554 BQ124112 BQ124087 CX520971 BG648364 BF003918 AJ497789 AJ497699 AJ497698 AL371106 AL366014 AL366013 BF635397 BF633516 BI267342 BE322104 BF640388 GE350928 GE351713 GE347298 GE346047 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02865 large subunit ribosomal protein L10Ae |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.42998.1.S1_at
|
Corresponding NCBI Gene | 817299 |
Trichome-related Gene from Literature | N/A |