Detail of EST/Unigene TCMT42714 |
Acc. | TCMT42714 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 60S ribosomal protein L30 OS=Lupinus luteus E-value=1e-59; 60S ribosomal protein L30 OS=Euphorbia esula E-value=2e-55; Putative 60S ribosomal protein L30-1 OS=Arabidopsis thaliana E-value=4e-53; 60S ribosomal protein L30-2 OS=Arabidopsis thaliana E-value=1e-52; 60S ribosomal protein L30-3 OS=Arabidopsis thaliana E-value=2e-52; |
Length | 682 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED (7 ESTs); MtBB_NOD (6 ESTs); MT_JCVI-MT2 (5 ESTs); MT_NOD_NOLLY (4 ESTs); MT_DFLOWER (4 ESTs); MtBC_GLOMUS (4 ESTs); MTAMP (3 ESTs); MT_INSECT (3 ESTs); MT_JCVI-MT1 (3 ESTs); MT_ROOTPHOS (3 ESTs); MT_Drought (2 ESTs); MT_SROOT_KV2 (2 ESTs); MT_ECELL (2 ESTs); MT_MGHG (2 ESTs); MT_CDS (1 ESTs); MTGIM (1 ESTs); MHRP-root (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_PhoLEAF (1 ESTs); MT_SIRRA (1 ESTs); MT_SROOT_KV1 (1 ESTs); MTFLOW (1 ESTs); MT_NOD_GVN (1 ESTs); |
Sequence | GGAGAGGCAGTGTTACACATTCATTTCCCTCGCCGCATTTTCTTCTCTGCGAATCTCACA |
EST members of Unigene | BT051384 DY618370 DY617597 DY617496 DY615745 CF069190 AL385759 AL385758 AL384252 AL384173 AL378582 AL378581 AL375740 AL375739 AL374076 AL374075 CX540632 CX537051 CX536730 CX536155 CX536026 BI268778 BI268426 BQ135993 BF645896 EV262475 EV257370 EV256701 BG580203 AW329249 AW287992 AW125983 AJ503013 AJ502571 AJ501466 AJ500249 BE240559 BQ149257 BQ149249 BI272717 BI272162 BM779821 AW299177 BE324346 BI269623 BF003787 AJ497820 BE943081 BE941912 BF636325 BF632465 BG449245 BE322223 BE321151 GE350540 GE348996 GE343854 GE345607 GE343695 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02908 large subunit ribosomal protein L30e |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.23423.1.S1_at
|
Corresponding NCBI Gene | 840530 |
Trichome-related Gene from Literature | N/A |