Detail of EST/Unigene TCMT42734 |
Acc. | TCMT42734 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S7-1 OS=Arabidopsis thaliana E-value=3e-86; 40S ribosomal protein S7 OS=Avicennia marina E-value=2e-85; 40S ribosomal protein S7 OS=Secale cereale E-value=6e-85; 40S ribosomal protein S7 OS=Oryza sativa subsp. japonica E-value=4e-84; 40S ribosomal protein S7-2 OS=Arabidopsis thaliana E-value=8e-84; |
Length | 854 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA (7 ESTs); MT_JCVI-MT2 (5 ESTs); MtBB_NOD (5 ESTs); MT_ECELL (4 ESTs); MT_JCVI-MT1 (4 ESTs); MT_INSECT (4 ESTs); MT_NOD_NOLLY (3 ESTs); MT_DFLOWER (3 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_GSEED (2 ESTs); MT_DLEAF (2 ESTs); MT_NOD_GVN (2 ESTs); MTAMP (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_GESD (1 ESTs); MHRP-root (1 ESTs); MT_TRI (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_DSTEM2 (1 ESTs); MT_DSIL (1 ESTs); MT_PhoLEAF (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_MGHG (1 ESTs); MT_Drought (1 ESTs); MT_DSLC (1 ESTs); |
Sequence | GGATTCTCAGTGCTGTTCTATCTCTCACTCTCTCTCTGCGGCTGAACAAGAACAACCTTC |
EST members of Unigene | DY617263 DY617228 DY616589 CF068011 CA918740 AL376793 AL375020 AL375019 AL374183 AL374182 CX541013 CX539477 AW208052 AW695058 BG447764 BF650669 BF648568 BF644206 EV259535 EV259375 EV258507 EV257396 DW016435 BG580655 AW573961 BF006490 AJ501532 CA990596 BG588733 BQ148612 BI271794 BI270889 BE316517 AW683147 AW776346 BG456779 AL372229 AL372228 AL369793 AL369021 AL369020 AL368433 AL368432 BE941361 BE247914 BI267699 BI267002 BI265392 BF641972 EY478265 GE352668 GE350764 GE348390 GE345865 GE345058 EX531631 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02993 small subunit ribosomal protein S7e |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37218.1.S1_at
|
Corresponding NCBI Gene | 841305 |
Trichome-related Gene from Literature | N/A |