Detail of EST/Unigene TCMT43310 |
Acc. | TCMT43310 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Calcium-binding protein PBP1 OS=Arabidopsis thaliana E-value=5e-34; Calcium-binding protein KIC OS=Arabidopsis thaliana E-value=9e-27; Caltractin (Fragment) OS=Spermatozopsis similis E-value=2e-09; Centrin-2 OS=Mus musculus E-value=3e-09; Centrin-1 OS=Homo sapiens E-value=4e-09; |
Length | 854 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_MGHG (4 ESTs); MT_JCVI-MT2 (4 ESTs); MtBB_NOD (4 ESTs); MT_NOD_GVN (3 ESTs); MT_DSIL (3 ESTs); MT_NOD_GVSN (2 ESTs); MHRP-root (2 ESTs); MtBC_GLOMUS (2 ESTs); MT_IROOT_DSIR (1 ESTs); MT_HOGA (1 ESTs); MT_Shoots (1 ESTs); MT_ECELL (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_TRI (1 ESTs); MT_ROOTPHOS (1 ESTs); MTAMP (1 ESTs); MT_CDS (1 ESTs); MTPOSE (1 ESTs); |
Sequence | GGATTCTTCATCATTCATTATAATTCATAACCCTTAATCTCTCTTATCTTCTCTTCTACA |
EST members of Unigene | BT051435 AL387516 AL387515 AL380158 AL380157 AL378955 AL378954 AW207936 CX523710 BF647684 EV258026 BE998674 AW208200 BG583857 BG583254 AW980335 AW126244 AJ501412 BG589138 BG589094 BF520618 BF519217 BE124173 AJ498947 BG646911 BE942825 BE941234 BE941127 BE941045 GE352122 GE347765 GE349360 GE344261 EX530617 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10840 centrin-2 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 9.A.1 Polysaccharide transporter PST; 9.A.14 Nuclear pore complex NPC |
Probeset |
Mtr.16859.1.S1_at
|
Corresponding NCBI Gene | 835537 |
Trichome-related Gene from Literature | N/A |