Detail of EST/Unigene TCMT49567 |
Acc. | TCMT49567 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Small ubiquitin-related modifier 1 OS=Arabidopsis thaliana E-value=8e-43; Small ubiquitin-related modifier 1 OS=Oryza sativa subsp. japonica E-value=2e-41; Small ubiquitin-related modifier 2 OS=Arabidopsis thaliana E-value=3e-41; Ubiquitin-like protein pmt3/smt3 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-22; Small ubiquitin-related modifier 1 OS=Xenopus tropicalis E-value=6e-19; |
Length | 764 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (4 ESTs); MT_JCVI-MT1 (3 ESTs); MTAMP (2 ESTs); MT_JCVI-MT3 (2 ESTs); MHRP-root (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_DFLOWER (2 ESTs); MT_DSIL (2 ESTs); MT_PhoLEAF (2 ESTs); MT_JAS_ROOR (2 ESTs); MT_FLOSEED_MTY (2 ESTs); MT_TRI (1 ESTs); MTPOSE (1 ESTs); MT_CDS (1 ESTs); MT_SIRRA (1 ESTs); MT_HOGA (1 ESTs); MT_NOD_GVSN (1 ESTs); MT_KVKC (1 ESTs); MT_NOD_GVN (1 ESTs); MT_Drought (1 ESTs); |
Sequence | GGACACACAGCACAATTGTCGGCGGTAACACAGAAAAGCACTTTTGTTCAGAGAATCGCG |
EST members of Unigene | BT051181 AL384683 AL384682 AL384675 AL384674 EV260629 EV256057 EV254974 DW016639 DW016207 BE999834 BG580437 AJ503148 AJ501746 BE240642 BE239467 BI272243 BI271102 BF518626 AW127473 AJ499062 BG455802 BG455729 BQ154113 CX529559 CX529065 CB895180 BQ255132 BG450676 EY474336 EY474306 GE349423 GE344333 EX533309 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37380.1.S1_at
|
Corresponding NCBI Gene | 828791 |
Trichome-related Gene from Literature | N/A |