| Detail of EST/Unigene TCMT52631 |
| Acc. | TCMT52631 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S3a OS=Cicer arietinum E-value=0; 40S ribosomal protein S3a OS=Catharanthus roseus E-value=0; 40S ribosomal protein S3a-1 OS=Vitis vinifera E-value=0; 40S ribosomal protein S3a OS=Daucus carota E-value=0; 40S ribosomal protein S3a-1 OS=Arabidopsis thaliana E-value=0; |
| Length | 1156 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2 (5 ESTs); MT_SEEDROOT_KV3 (4 ESTs); MT_DFLOWER (4 ESTs); MT_GSEED (4 ESTs); MT_NOD_GVN (4 ESTs); MtBA (3 ESTs); MtBC_GLOMUS (3 ESTs); MT_INSECT (3 ESTs); MT_SROOT_KV2 (3 ESTs); MT_TRI (3 ESTs); GLSD (3 ESTs); MT_JCVI-MT1 (3 ESTs); MT_JAS_ROOR (3 ESTs); MtBB_NOD (2 ESTs); MT_DLEAF (2 ESTs); MT_DSIL (2 ESTs); MT_JCVI-MT3 (2 ESTs); MTFLOW (1 ESTs); MT_NOD_NOLLY (1 ESTs); MT_MGHG (1 ESTs); MT_Drought (1 ESTs); MT_DROOT (1 ESTs); MTPOSE (1 ESTs); MT_Shoots (1 ESTs); MT_SIRRA (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_VILEAF (1 ESTs); MT_CDS (1 ESTs); MT_NOD_ROOT (1 ESTs); |
| Sequence | GTTGCTGTACTCTGAGCCGTCACTAGAACTCTCACTCTTATCACTGCCAACAGTGAAACC |
| EST members of Unigene | BT053090 DY615520 AL386473 AL386472 AL384836 AL375600 AL375599 BE320674 CX539865 CX539391 CX538326 CX537892 CX526342 AW697415 AW691655 AW695270 AW689842 AW688058 EV260537 EV260054 EV258391 DW019296 BG581030 BG581029 BG580952 AW573679 AW686075 CB891619 CB891458 BG646122 AW773934 BQ149207 BQ149203 BQ147260 BI272615 AW683403 BE249800 BF519448 AW776373 AJ498997 BM779425 BM779231 AW256572 CA858402 BQ124510 BQ124392 BQ157718 CX521875 CX530940 CX530930 CX528701 AJ497157 AL371012 AL371011 AL365724 BE941674 BE248073 BI265944 BG449246 BE322002 EY474733 EY474725 EX531681 ES613258 ES613036 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02984 small subunit ribosomal protein S3Ae |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.10426.1.S1_at, Mtr.35602.1.S1_s_at
|
| Corresponding NCBI Gene | 819644 |
| Trichome-related Gene from Literature | N/A |