| Detail of EST/Unigene TCMT52640 |
| Acc. | TCMT52640 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable carboxylesterase 2 OS=Arabidopsis thaliana E-value=8e-65; Probable carboxylesterase 4 OS=Arabidopsis thaliana E-value=7e-63; Probable carboxylesterase 12 OS=Arabidopsis thaliana E-value=7e-63; Probable carboxylesterase 3 OS=Arabidopsis thaliana E-value=2e-59; Probable carboxylesterase 5 OS=Arabidopsis thaliana E-value=4e-59; |
| Length | 1362 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL (15 ESTs); MtBB_NOD (6 ESTs); MT_DROOT (5 ESTs); MT_HOGA (5 ESTs); MT_JCVI-MT3 (3 ESTs); MT_IROOT_DSIR (3 ESTs); MTAMP (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_SEEDROOT_KV3 (2 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_DSIL (2 ESTs); MT_VILEAF (2 ESTs); MT_NOD_GVN (2 ESTs); MtBA (2 ESTs); MT_NOD_ROOT (2 ESTs); MHRP-root (1 ESTs); MT_SROOT_KV2 (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_Shoots (1 ESTs); MT_KVKC (1 ESTs); MT_INSECT (1 ESTs); |
| Sequence | GGAACCTTCTCTGTTCTACTCTCTTCACTTCCCTTCATCAATGGCTTCTTCAACCAAAGA |
| EST members of Unigene | CF069358 CA919873 AL374799 AL374798 AL374380 AL374379 AL373880 AL373879 BG448476 BE320559 BE320316 BE319923 BE320230 AW208074 AW207986 AW559247 CX527630 BI262805 BG448390 BG448369 BG448258 BF650955 BF650327 BF650241 BF647493 BF647008 BF646919 BF646547 BF646496 BF646425 BF646209 BF643577 BG580605 BG580488 AW685746 AW684691 AJ504387 AJ502148 BE240377 AW775051 AW774069 AW776768 AW776116 AW257314 CX520451 CX519623 CX535383 CB894706 CB894703 CB894480 CB893578 BG647001 BQ164971 AL371830 AL371829 BG449736 EY478424 EY476809 EY474643 GE350553 GE345622 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00960 Alkaloid biosynthesis II > K01066 esterase / lipase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00623 2,4-Dichlorobenzoate degradation > K01066 esterase / lipase |
| EC | 3.1.1.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.10466.1.S1_at
|
| Corresponding NCBI Gene | 841155 |
| Trichome-related Gene from Literature | N/A |