| Detail of EST/Unigene TCMT52653 |
| Acc. | TCMT52653 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Hydroquinone glucosyltransferase OS=Rauvolfia serpentina E-value=0; UDP-glycosyltransferase 72B1 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 72B3 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 72B2 OS=Arabidopsis thaliana E-value=0; Anthocyanidin 3-O-glucosyltransferase 5 OS=Manihot esculenta E-value=4e-90; |
| Length | 1772 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2 (6 ESTs); MT_DSIL (5 ESTs); MT_NOD_ROOT (4 ESTs); MT_INSECT (3 ESTs); MT_DLEAF (3 ESTs); MT_GPOD (3 ESTs); MT_SROOT_KV2 (3 ESTs); MT_KVKC (2 ESTs); MT_Drought (2 ESTs); MT_GSEED (2 ESTs); MT_Shoots (2 ESTs); MT_ECELL (2 ESTs); MT_NOD_GVN (2 ESTs); MT_HOGA (1 ESTs); MT_CDS (1 ESTs); MTAMP (1 ESTs); MtBC_GLOMUS (1 ESTs); MHRP-root (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_PhoLEAF (1 ESTs); |
| Sequence | CTCTGCCTCCTTTACAGACAGACCATAATAAAAACTCTTTTCTTTGTTCTATATATAATT |
| EST members of Unigene | BT053145 AL387103 CX537062 BI268780 AW560834 CX527098 CX526364 AW691619 AW691143 AW694224 AW692511 AW691874 AW689514 BF646625 BF643291 EV261440 DW017682 BG582601 AW573699 AW685026 AW684487 AW684400 AW684369 AJ501182 BG588506 AW736437 BG454924 BG454646 BG453054 CB066724 CA917853 CA917527 BF520992 BF519930 AW776664 AW776172 AW775831 BM779087 AW257055 AW256404 BE204477 BE324728 CB065427 BQ750520 BQ165075 BF635114 BF633668 BI267146 BI265168 BF639617 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase |
| EC | 2.4.1.17 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.40255.1.S1_at
|
| Corresponding NCBI Gene | 827912 |
| Trichome-related Gene from Literature | N/A |