Detail of EST/Unigene TCMT55791 |
Acc. | TCMT55791 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Isoflavone reductase homolog A622 OS=Nicotiana tabacum E-value=0; Isoflavone reductase homolog P3 OS=Arabidopsis thaliana E-value=0; Isoflavone reductase homolog OS=Solanum tuberosum E-value=0; Isoflavone reductase OS=Medicago sativa E-value=0; Isoflavone reductase homolog IRL OS=Zea mays E-value=0; |
Length | 1470 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2 (6 ESTs); MtBB_NOD (4 ESTs); MT_SEEDROOT_KV3 (3 ESTs); MT_SROOT_KV1 (3 ESTs); MT_ECELL (3 ESTs); MT_GESD (2 ESTs); MHRP-root (2 ESTs); MT_IROOT_DSIR (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_NOD_GVSN (2 ESTs); MT_NOD_GVN (2 ESTs); MT_Drought (2 ESTs); MT_CDS (1 ESTs); MT_NOD_NOLLY (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_SIRRA (1 ESTs); MTAPHEU (1 ESTs); MT_HOGA (1 ESTs); MT_KVKC (1 ESTs); MtBA (1 ESTs); MT_MGHG (1 ESTs); MT_NOD_ROOT (1 ESTs); |
Sequence | GGGTAGCATGGAATATTGAACTAATGACTATTGTGACTAAGGACATTTATGTCCATTAGG |
EST members of Unigene | BT051665 DY615675 CF068536 AL380571 AL380570 AL375963 AL375962 AJ547989 AW560880 AW559440 BF650005 BF647800 BF644034 EV257985 EV255360 BE998521 AW208141 BG580834 AW980642 AW684683 BI312226 BI312208 BG588623 BG588602 CB891161 AW736641 AW736640 BQ152677 CB893466 BF004722 BF004721 BE202794 BQ255216 AL372431 BE941911 BG450252 BF635180 GE350159 GE350217 GE350673 GE345182 GE345766 GE345242 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.32289.1.S1_s_at, Mtr.8604.1.S1_at
|
Corresponding NCBI Gene | 843865 |
Trichome-related Gene from Literature | 843865 |