Detail of EST/Unigene TCMT56018 |
Acc. | TCMT56018 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Protein usf OS=Aquifex pyrophilus E-value=2e-19; Putative uncharacterized protein yghX OS=Escherichia coli (strain K12) E-value=8e-16; Putative carboxymethylenebutenolidase OS=Aquifex aeolicus (strain VF5) E-value=2e-15; Carboxymethylenebutenolidase OS=Pseudomonas sp. (strain B13) E-value=2e-10; Carboxymethylenebutenolidase OS=Pseudomonas putida E-value=2e-10; |
Length | 1107 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVN (2 ESTs); MT_CDS (2 ESTs); MtBA (2 ESTs); MT_INSECT (2 ESTs); MTAMP (1 ESTs); MT_GPOD (1 ESTs); MT_DSIL (1 ESTs); MTPOSE (1 ESTs); MT_NOD_NOLLY (1 ESTs); MT_SIRRA (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_HOGA (1 ESTs); MT_GSEED (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_Drought (1 ESTs); MT_DSTEM2 (1 ESTs); MT_JCVI-MT1 (1 ESTs); |
Sequence | GAGATTTATAACACTGTTGTGAGTAAAAGGAATGCTGAGATTTATAACATCATCATCTGC |
EST members of Unigene | BT051876 BT050755 DY616332 CF069518 CX539102 AW560317 AW693756 EV256726 BG581843 AW980695 AJ503355 BI308353 AW775439 AJ498056 BI269877 BG647501 AL367651 AL367650 BF635205 BI265807 BE321910 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00627 1,4-Dichlorobenzene degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00364 Fluorobenzoate degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K01061 carboxymethylenebutenolidase |
EC | 3.1.1.45 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1513.1.S1_at, Mtr.40507.1.S1_at
|
Corresponding NCBI Gene | 817813 |
Trichome-related Gene from Literature | N/A |