Detail of EST/Unigene TCMT58850 |
Acc. | TCMT58850 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase OS=Arabidopsis thaliana E-value=2e-35; Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase OS=Petunia hybrida E-value=1e-33; Aspartate aminotransferase OS=Aquifex aeolicus (strain VF5) E-value=2e-33; Aspartate aminotransferase OS=Pyrococcus abyssi (strain GE5 / Orsay) E-value=1e-32; Aspartate aminotransferase OS=Thermotoga maritima (strain ATCC 43589 / MSB8 / DSM 3109 / JCM 10099) E-value=1e-30; |
Length | 1878 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_UV-B (9 ESTs); MtBA (7 ESTs); MT_JAS_ROOR (6 ESTs); MT_INSECT (4 ESTs); MT_DSTEM2 (3 ESTs); MT_ECELL (3 ESTs); MT_JCVI-MT1 (2 ESTs); MT_NOD_GVN (2 ESTs); MT_NOD_ROOT (2 ESTs); MT_SEEDROOT_KV3 (2 ESTs); MT_GPOD (2 ESTs); MT_DSIL (2 ESTs); MT_SROOT_KV2 (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_PhoLEAF (1 ESTs); MT_VILEAF (1 ESTs); MT_HOGA (1 ESTs); MT_MGHG (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_Drought (1 ESTs); MT_CDS (1 ESTs); MT_JCVI-MT3 (1 ESTs); MtBB_NOD (1 ESTs); |
Sequence | CAATCCCATTTTTTTCTAACCACCCTTTGTCTCTTTCTTCACCTTTTTCACAGATTTTGT |
EST members of Unigene | BT051721 AL378469 AW696254 AW695401 AW690226 BF651252 BF648107 BF643853 EV261334 EV255724 BG583788 BE124703 DY633260 DY633224 DY633143 DY633105 DY633033 DY633030 DY632723 DY632530 DY632457 AW686170 AW685094 AW774036 AW774035 BQ140072 CA918297 BI308013 BF520728 AW777020 AW256848 BE205133 BE324185 CX517528 CX533257 CX533227 CX533211 CX533024 CX531958 CX528635 BG649030 AL371679 AL371678 AL370843 AL370842 AL366084 AL365949 AL365948 BE942812 BG450552 BI268186 BI267169 BG449785 BG449187 EY478606 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00815 tyrosine aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00815 tyrosine aminotransferase |
EC | 2.6.1.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.43137.1.S1_at
|
Corresponding NCBI Gene | 844376 |
Trichome-related Gene from Literature | N/A |