Detail of EST/Unigene TCMT58995 |
Acc. | TCMT58995 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin--NADP reductase, root isozyme, chloroplastic OS=Pisum sativum E-value=0; Ferredoxin--NADP reductase, root-type isozyme, chloroplastic OS=Nicotiana tabacum E-value=0; Ferredoxin--NADP reductase, root isozyme 2, chloroplastic OS=Arabidopsis thaliana E-value=0; Ferredoxin--NADP reductase, root isozyme 1, chloroplastic OS=Arabidopsis thaliana E-value=0; Ferredoxin--NADP reductase, root isozyme, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; |
Length | 1831 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_KVKC (2 ESTs); MT_ROOTPHOS (2 ESTs); MT_CDS (2 ESTs); MtBC_GLOMUS (2 ESTs); MT_SEEDROOT_KV3 (2 ESTs); MtBB_NOD (2 ESTs); MT_DSTEM2 (2 ESTs); MT_NOD_GVSN (2 ESTs); MT_DSLC (1 ESTs); MT_INSECT (1 ESTs); MT_JCVI-MT3 (1 ESTs); MTAMP (1 ESTs); MT_BML (1 ESTs); MHRP-root (1 ESTs); MT_GPOD (1 ESTs); MT_Shoots (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_SIRRA (1 ESTs); MT_ECELL (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_HOGA (1 ESTs); |
Sequence | AATCAGATTATTGGAGTTAAGAATTCCAAGTTGGCGAAGACTACTACACTCCGAGAAGCC |
EST members of Unigene | BT052275 BT050856 AL389693 AL384977 AL377469 AL377468 CX524290 AW692240 AW690788 BF645439 EV261632 BE999164 BE998855 AW127571 AW328853 AW171758 AJ501809 BE240351 CB891783 AW775130 BI308369 AI974351 BQ155671 CX534060 BG647868 BQ750420 BQ164808 BI267692 EY477753 GD185078 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.14.13.39 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37556.1.S1_at
|
Corresponding NCBI Gene | 839930 |
Trichome-related Gene from Literature | N/A |