Detail of EST/Unigene TCMT40533 |
Acc. | TCMT40533 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Basic leucine zipper and W2 domain-containing protein 2 OS=Mus musculus molossinus E-value=1e-57; Basic leucine zipper and W2 domain-containing protein 2 OS=Mus musculus E-value=1e-57; Basic leucine zipper and W2 domain-containing protein 2 OS=Macaca fascicularis E-value=1e-57; Basic leucine zipper and W2 domain-containing protein 2 OS=Homo sapiens E-value=1e-57; Basic leucine zipper and W2 domain-containing protein 2 OS=Rattus norvegicus E-value=2e-57; |
Length | 1853 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2 (15 ESTs); MtBB_NOD (6 ESTs); MT_LEAF_PHOMA (6 ESTs); MT_JAS_ROOR (6 ESTs); MtBA (5 ESTs); MT_INSECT (5 ESTs); MT_IROOT_DSIR (4 ESTs); MT_GPOD (4 ESTs); MT_ECELL (4 ESTs); MT_SROOT_KV0 (4 ESTs); MT_HOGA (3 ESTs); MtBC_GLOMUS (3 ESTs); MT_SEEDROOT_KV3 (3 ESTs); MTFLOW (3 ESTs); MT_Drought (3 ESTs); MT_JCVI-MT1 (3 ESTs); MT_NOD_GVN (3 ESTs); MT_NOD_ROOT (3 ESTs); MT_DLEAF (2 ESTs); MT_DSIL (2 ESTs); MT_PhoLEAF (2 ESTs); MT_ROOTPHOS (2 ESTs); MT_DFLOWER (1 ESTs); MtRHE (1 ESTs); MT_Shoots (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_SROOT_KV2 (1 ESTs); MT_BML (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_NOD_NOLLY (1 ESTs); |
Sequence | TGATTACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
EST members of Unigene | DY616877 AL389221 AL389220 AL386811 AL381256 AL381255 AL381147 AL381146 AL377534 AL377533 AW560457 AW560354 AW559821 AW559677 CX526168 AW692750 BE325923 AW696126 AW696238 BE325034 AW688271 AW696337 AW694622 AW690669 AW690652 AW690474 AW689986 AW689069 AW688787 AW688027 BQ136271 BI262812 BF647519 BF643815 EV258078 EV256656 EV254892 DW015591 BG583670 BG583067 AW980884 AW686535 AW685414 AW684097 AW171638 AW171673 BG644889 AW774086 AW736545 BI271741 BQ140011 BQ139545 BQ139045 BQ138702 BQ138093 BQ138038 BE315644 BF637191 CA917252 CA916963 BI308814 BI308671 BF518625 AW775861 AW257220 BE204833 BE204909 BE203682 BE203497 BI264312 BG457598 CX534525 CX532612 CX532137 CX529846 CX528749 CX528694 CB893423 BG648887 BG646328 AJ497362 AJ497346 AJ497199 AA660835 AL373056 AL373055 AL369421 AL368490 AL368489 BG451957 BG450403 BF632263 BI267476 BI265331 BE321713 BE321825 BF641827 EY476753 GD185538 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.2789.1.S1_at, Mtr.23881.1.S1_at
|
Corresponding NCBI Gene | 833620 |
Trichome-related Gene from Literature | N/A |