| Detail of EST/Unigene TCMT49681 |
| Acc. | TCMT49681 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | NADP-dependent D-sorbitol-6-phosphate dehydrogenase OS=Malus domestica E-value=0; Aldose reductase A OS=Dictyostelium discoideum E-value=4e-61; Probable NAD(P)H-dependent D-xylose reductase xyl1 OS=Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / FGSC A1164 / NRRL 181) E-value=2e-59; Probable NAD(P)H-dependent D-xylose reductase xyl1 OS=Neosartorya fumigata (strain ATCC MYA-4609 / Af293 / CBS 101355 / FGSC A1100) E-value=3e-58; Probable NAD(P)H-dependent D-xylose reductase xyl1 OS=Neosartorya fumigata (strain CEA10 / CBS 144.89 / FGSC A1163) E-value=3e-58; |
| Length | 1201 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2 (6 ESTs); MtBC_GLOMUS (3 ESTs); MT_JCVI-MT1 (3 ESTs); MT_DSIL (3 ESTs); MtBA (2 ESTs); MT_FLOSEED_MTY (2 ESTs); MT_Drought (1 ESTs); MT_NOD_NOLLY (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_NOD_GVSN (1 ESTs); MT_NOD_ROOT (1 ESTs); MTAMP (1 ESTs); MT_SROOT_KV0 (1 ESTs); |
| Sequence | ACTAGTGATCCCCGGGCTGCATGGAAAAAATGAATCACACTGAACAGCGGATTCAAGATG |
| EST members of Unigene | DY618109 AL389804 AL387765 AL387764 EV260034 EV258961 EV256175 DW017888 DW016824 BE997810 AW683974 AJ502475 BF520811 BF518726 AW981220 BE205422 AL367692 AL367691 BF632718 EY475309 GE352623 GE348340 GE349219 GE349715 GE344665 GE344109 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00011 aldehyde reductase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00011 aldehyde reductase |
| EC | 1.1.1.21 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.49639.1.S1_at
|
| Corresponding NCBI Gene | 816664 |
| Trichome-related Gene from Literature | N/A |