| Detail of EST/Unigene TCMT55712 |
| Acc. | TCMT55712 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable mitochondrial-processing peptidase subunit beta OS=Arabidopsis thaliana E-value=0; Mitochondrial-processing peptidase subunit beta OS=Bos taurus E-value=0; Mitochondrial-processing peptidase subunit beta OS=Mus musculus E-value=0; Mitochondrial-processing peptidase subunit beta OS=Pongo abelii E-value=0; Mitochondrial-processing peptidase subunit beta OS=Rattus norvegicus E-value=0; |
| Length | 1974 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBA (11 ESTs); MT_Drought (10 ESTs); MT_DSTEM2 (7 ESTs); MT_JAS_ROOR (5 ESTs); MT_INSECT (5 ESTs); MT_Shoots (5 ESTs); MT_ECELL (4 ESTs); MT_NOD_GVSN (4 ESTs); MT_VILEAF (3 ESTs); MtBC_GLOMUS (3 ESTs); MtBB_NOD (3 ESTs); MT_DROOT (3 ESTs); MT_GPOD (3 ESTs); MT_DSIL (3 ESTs); MT_GSEED (2 ESTs); MT_SROOT_KV2 (2 ESTs); MT_PhoLEAF (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_NOD_GVN (1 ESTs); MT_GESD (1 ESTs); MT_MGHG (1 ESTs); MT_DFLOWER (1 ESTs); MT_DLEAF (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_JCVI-MT2 (1 ESTs); MT_SROOT_KV0 (1 ESTs); |
| Sequence | AGCACATTCGGAATCACTCTTTTTTTCTCTTTCCCTTTCTCTATTTCATCGTTTTTCACA |
| EST members of Unigene | AL386732 AL386731 AL383710 AL377660 AL377658 AL377657 BE319232 AW687430 AW687414 CX539154 CX538528 AW559346 CX526722 CX526135 CX525739 CX524408 CX524075 AW694217 AW692775 AW695184 AW692122 AW694271 AW689330 AW687977 BG448004 BF649317 BF648110 BF648020 EV260237 BE999435 BE998296 BE997722 BE997550 BG580718 BI311587 BQ149305 BG454737 CA917634 CA917063 BI308027 BF519693 BF519692 AW127436 AW257332 AW256906 BE204821 BG456564 CX523319 CX520657 CX517290 CX534795 CX533964 CX530799 CX530585 CX530490 AL372646 AL372645 AL371181 AL371180 AL370937 AL370936 AL370533 AL370532 AL369676 AL365767 AL365766 BE941292 BG451694 BG451326 BG451203 BE248563 BE249186 BE248103 BF636375 BF633331 BF632425 BF632357 BI267829 BI265841 BE322858 BF642616 BF640684 EY473973 GE347303 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.4.24.64 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1167.1.S1_at, Mtr.1552.1.S1_s_at, Mtr.8535.1.S1_at
|
| Corresponding NCBI Gene | 821084 |
| Trichome-related Gene from Literature | N/A |