| Detail of EST/Unigene TCMT55723 |
| Acc. | TCMT55723 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Farnesyl pyrophosphate synthase 1 OS=Lupinus albus E-value=0; Farnesyl pyrophosphate synthase 2 OS=Lupinus albus E-value=0; Farnesyl pyrophosphate synthase 2 OS=Parthenium argentatum E-value=0; Farnesyl pyrophosphate synthase OS=Helianthus annuus E-value=0; Farnesyl pyrophosphate synthase OS=Artemisia annua E-value=0; |
| Length | 1523 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT (8 ESTs); MtBB_NOD (7 ESTs); MT_Shoots (6 ESTs); MT_GSEED (5 ESTs); MT_NOD_GVN (5 ESTs); MT_SEEDROOT_KV3 (5 ESTs); MtBA (5 ESTs); MT_DROOT (5 ESTs); MT_DFLOWER (4 ESTs); MT_SROOT_KV2 (3 ESTs); MT_DSIL (2 ESTs); MT_SROOT_KV0 (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_KVKC (2 ESTs); MT_JCVI-MT3 (1 ESTs); MT_IROOT_DSIR (1 ESTs); GLSD (1 ESTs); MT_ECELL (1 ESTs); MT_PhoLEAF (1 ESTs); MT_SIRRA (1 ESTs); MT_JAS_ROOR (1 ESTs); MHRP-root (1 ESTs); MT_SROOT_KV1 (1 ESTs); MT_CDS (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_DLEAF (1 ESTs); |
| Sequence | GCAGCCACACTACCGGCTGTGCAGCATCTCTCTTTCTCTTCCATTCCTCTATTTATTCTC |
| EST members of Unigene | BT051765 CA921671 AL380929 AL378677 AL378676 AL378078 AL374976 AL374975 AL374729 BE319733 AW687525 BE319827 AW687388 BE320742 CX540958 CX540489 CX539129 CX536466 BI268480 AW559796 CX527972 CX527393 CX527207 CX526783 CX525586 CX525401 BG448392 EV256438 EV256066 BG582908 BG581573 BG580343 BG580340 BG580090 BE240565 CB891732 CB891393 BG646173 BG645933 BG645148 BQ148648 BQ147236 BQ146440 BI270572 BG452720 BF520521 BF520039 AW257071 AW256394 AW256393 BE205487 AW225610 BQ124378 BG456530 BQ155309 CX531189 BE203240 BQ750501 BQ165063 AL370161 AL370160 AL368050 AL368049 AL367098 BI266264 BG449420 BG449056 BG448995 BG448888 BF642273 BF641892 BF640621 EY475406 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00787 dimethylallyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00787 dimethylallyltranstransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00795 geranyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00795 geranyltranstransferase |
| EC | 2.5.1.1 2.5.1.10 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.3021.1.S1_at, Mtr.17661.1.S1_at
|
| Corresponding NCBI Gene | 834828 |
| Trichome-related Gene from Literature | N/A |