Detail of EST/Unigene TCMT40621 |
Acc. | TCMT40621 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase leaf isozyme, chloroplastic OS=Medicago sativa E-value=0; Glutamine synthetase leaf isozyme, chloroplastic OS=Pisum sativum E-value=0; Glutamine synthetase leaf isozyme, chloroplastic OS=Phaseolus vulgaris E-value=0; Glutamine synthetase, chloroplastic OS=Daucus carota E-value=0; Glutamine synthetase, chloroplastic OS=Brassica napus E-value=0; |
Length | 1693 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (7 ESTs); MT_VILEAF (7 ESTs); MT_INSECT (6 ESTs); MT_DSTEM2 (4 ESTs); MT_DSIL (3 ESTs); MT_CDS (3 ESTs); MT_JCVI-MT2 (3 ESTs); MT_LEAF_PHOMA (3 ESTs); MT_DLEAF (3 ESTs); MT_NOD_NOLLY (1 ESTs); MTFLOW (1 ESTs); MT_GSEED (1 ESTs); MtBA (1 ESTs); MT_Shoots (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_NOD_GVN (1 ESTs); MT_TRI (1 ESTs); |
Sequence | TGATNCGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
EST members of Unigene | BT050850 BT052213 AY225150 DY617771 CX538671 CX526029 AW688552 AW693739 AW691414 AW689288 EV258856 AW573676 BQ140918 BQ140352 BQ139196 BE319151 BE249789 BE317419 BF521090 AW981308 AW981288 BI264499 BG458121 BE323758 BE323101 BE324507 BE323583 BE324698 CX523444 CX520994 CX518061 CX517979 CX517586 CX517086 CX516896 AJ497706 AL372792 BI268095 BE321399 BE321453 BF641600 BF639835 BE322970 EY475190 GE351091 GE346337 GE346336 EX533264 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
EC | 6.3.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.10480.1.S1_at, Mtr.4818.1.S1_s_at
|
Corresponding NCBI Gene | 833535 |
Trichome-related Gene from Literature | N/A |