| Detail of EST/Unigene TCMT41458 |
| Acc. | TCMT41458 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Thiamine thiazole synthase 2, chloroplastic OS=Vitis vinifera E-value=0; Thiamine thiazole synthase, chloroplastic OS=Citrus sinensis E-value=0; Thiamine thiazole synthase 1, chloroplastic OS=Vitis vinifera E-value=0; Thiamine thiazole synthase 3, chloroplastic OS=Physcomitrella patens subsp. patens E-value=0; Thiamine thiazole synthase, chloroplastic OS=Alnus glutinosa E-value=0; |
| Length | 1365 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2 (26 ESTs); MT_NOD_GVN (16 ESTs); MtBC_GLOMUS (6 ESTs); MT_SEEDROOT_KV3 (6 ESTs); MT_SROOT_KV1 (5 ESTs); MT_PhoLEAF (5 ESTs); MT_NOD_GVSN (5 ESTs); MT_GESD (4 ESTs); MT_IROOT_DSIR (4 ESTs); MT_FLOSEED_MTY (4 ESTs); MT_Drought (3 ESTs); MTPOSE (3 ESTs); MT_JCVI-MT1 (3 ESTs); MtBA (2 ESTs); MT_ROOTPHOS (2 ESTs); MtBB_NOD (2 ESTs); MT_DLEAF (2 ESTs); MT_SROOT_KV0 (2 ESTs); MT_MGHG (1 ESTs); MT_NOD_NOLLY (1 ESTs); MHRP-root (1 ESTs); MT_INSECT (1 ESTs); MT_SROOT_KV2 (1 ESTs); |
| Sequence | CCTGATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCAC |
| EST members of Unigene | DY618418 AL386111 AL386110 AL385180 AL385179 AL383369 AL383368 AL373473 AL373472 AW559426 AW559408 AW559317 AW267764 BQ137127 BQ137108 AW694263 AW696571 AW696647 AW694805 AW693596 AW693357 AW694771 AW696553 AW693549 AW694768 AW693577 AW693508 AW693657 AW694966 AW695164 AW693111 BE325241 AW696372 AW695479 AW695364 AW689781 AW689760 AW688697 AW688688 EV261819 EV257836 EV257762 DW018708 DW018309 DW018185 DW017143 BE999397 BE998258 BE997998 BE997997 BE997996 BG583835 BG582832 BG582722 BG582630 BG581614 BG581595 BG581390 BG581332 BG580985 BG580984 BG580178 BE124907 AW574264 AW574216 AW574050 AW573828 AW329715 AW287876 CA989943 CA918527 CA918526 BI311683 BG589179 CB892098 CB891745 CB891617 CB891605 CB891488 CB891394 BG454537 BE318907 AJ498815 AJ498711 AJ498520 BM779472 BE205143 BE204324 BI264518 BE324106 BE322976 BE322974 BF638360 BF003978 BF003807 BF003677 BF003175 BE203461 AL371199 AL371198 BE942301 BG450862 BF633714 BF631990 BF639708 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1665.1.S1_at, Mtr.10393.1.S1_at
|
| Corresponding NCBI Gene | 835567 |
| Trichome-related Gene from Literature | N/A |