| Detail of EST/Unigene TCMT42074 |
| Acc. | TCMT42074 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin F-type, chloroplastic OS=Pisum sativum E-value=3e-55; Thioredoxin F2, chloroplastic OS=Arabidopsis thaliana E-value=5e-46; Thioredoxin F1, chloroplastic OS=Arabidopsis thaliana E-value=2e-45; Thioredoxin F-type, chloroplastic OS=Brassica napus E-value=1e-44; Thioredoxin F-type, chloroplastic OS=Mesembryanthemum crystallinum E-value=2e-43; |
| Length | 944 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_PhoLEAF (68 ESTs); MT_VILEAF (11 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_Shoots (2 ESTs); MT_INSECT (2 ESTs); MT_NOD_GVN (2 ESTs); MT_DSLC (1 ESTs); MT_DFLOWER (1 ESTs); MT_GPOD (1 ESTs); MT_DSIL (1 ESTs); MTPOSE (1 ESTs); MT_CDS (1 ESTs); MT_SIRRA (1 ESTs); MT_Drought (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
| Sequence | CTGATACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
| EST members of Unigene | BT051325 CF069329 CA919892 CX526922 CX524115 EV256710 AW981074 AW980960 BF005111 BI270506 BI309654 AW775760 AJ498800 BQ159147 BQ159105 BQ158908 BQ158723 BQ158712 BQ158696 BQ158693 BQ158692 BQ158685 BQ158677 BQ158676 BQ158673 BQ158669 BQ158657 BQ158639 BQ158635 BQ158628 BQ158625 BQ158619 BQ158616 BQ158599 BQ158591 BQ158590 BQ158511 BQ158504 BQ158499 BQ158497 BQ158496 BQ158495 BQ158475 BQ158448 BQ158446 BQ158425 BQ158424 BQ158439 BQ158438 BQ158434 BQ158408 BQ158405 BQ158400 BQ158398 BQ158395 BQ158391 BQ158390 BQ158384 BQ158379 BQ158370 BQ158366 BQ158343 BQ158339 BQ158295 BQ158265 BQ158239 BQ158238 BQ158237 BQ158231 BQ158212 BQ158209 BQ158206 BQ157837 BQ157818 BQ157815 BQ157808 BG456419 BF638169 BF638060 BF637682 BF637599 BQ153339 CX523529 CX523094 CX522773 CX522255 CX522254 CX522197 CX520403 CX519940 CX519305 CX518944 CX516812 BE247915 BG449818 BE322137 EY474981 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.43208.1.S1_at
|
| Corresponding NCBI Gene | 831501 |
| Trichome-related Gene from Literature | N/A |