| Detail of EST/Unigene TCMT42160 |
| Acc. | TCMT42160 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Ethylene-responsive transcription factor 6 OS=Arabidopsis thaliana E-value=1e-41; Ethylene-responsive transcription factor 5 OS=Arabidopsis thaliana E-value=9e-40; Ethylene-responsive transcription factor 5 OS=Nicotiana tabacum E-value=4e-35; Ethylene-responsive transcription factor 5 OS=Nicotiana sylvestris E-value=1e-33; Ethylene-responsive transcription factor 2 OS=Arabidopsis thaliana E-value=5e-27; |
| Length | 1177 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots (5 ESTs); MT_ECELL (4 ESTs); MT_DSIL (4 ESTs); MT_NOD_GVN (3 ESTs); MT_GPOD (3 ESTs); MT_JCVI-MT1 (2 ESTs); MtBA (2 ESTs); MT_Drought (2 ESTs); MT_JCVI-MT3 (2 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_LEAF_PHOMA (2 ESTs); MtBC_GLOMUS (2 ESTs); MtBB_NOD (2 ESTs); MT_VILEAF (1 ESTs); MT_HOGA (1 ESTs); MT_NOD_GVSN (1 ESTs); MT_MGHG (1 ESTs); MT_NOD_ROOT (1 ESTs); MT_INSECT (1 ESTs); MT_CDS (1 ESTs); MHRP-root (1 ESTs); MT_TRI (1 ESTs); MT_GSEED (1 ESTs); MT_SROOT_KV2 (1 ESTs); |
| Sequence | GAACACACAATCTCATCCTCTCTTCTTATCTTCTTCTTCTTCTTCTTCTTCAACAACTTT |
| EST members of Unigene | BT052514 CF068096 CA918826 AL388235 AL388234 AL376496 AL376495 CX537948 CX526729 CX526179 CX525776 CX524413 CX524179 BF651261 BF646779 BF646221 BF645204 EV261135 EV258330 BE997737 BG581182 AW980388 AW573782 AW685077 BE239893 BQ138491 BQ138415 CA917172 BI309617 BI308824 BE124228 AW981151 AW981228 AW776671 BM779603 CX520760 BG646879 AL372736 AL372735 BE942257 BG451872 BF634077 BI267179 EY477522 EY475862 ES612364 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | ERF |
| Transporter Classification Family | |
| Probeset |
Mtr.10424.1.S1_at
|
| Corresponding NCBI Gene | 827463 |
| Trichome-related Gene from Literature | N/A |