Detail of EST/Unigene TCMT49531 |
Acc. | TCMT49531 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | L-3-cyanoalanine synthase 1, mitochondrial OS=Malus domestica E-value=0; L-3-cyanoalanine synthase 2, mitochondrial OS=Malus domestica E-value=0; Bifunctional L-3-cyanoalanine synthase/cysteine synthase 1, mitochondrial OS=Solanum tuberosum E-value=0; Bifunctional L-3-cyanoalanine synthase/cysteine synthase C1, mitochondrial OS=Arabidopsis thaliana E-value=0; Bifunctional L-3-cyanoalanine synthase/cysteine synthase 2, mitochondrial OS=Solanum tuberosum E-value=0; |
Length | 1671 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots (4 ESTs); MtBA (3 ESTs); MT_NOD_NOLLY (3 ESTs); MT_DSIL (3 ESTs); MtBC_GLOMUS (3 ESTs); MT_NOD_GVSN (2 ESTs); MT_LEAF_PHOMA (2 ESTs); MT_JCVI-MT3 (2 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_SROOT_KV2 (2 ESTs); MtBB_NOD (2 ESTs); MT_SIRRA (2 ESTs); MT_VILEAF (2 ESTs); MT_JAS_ROOR (2 ESTs); MT_ECELL (2 ESTs); MT_JCVI-MT1 (1 ESTs); MT_INSECT (1 ESTs); MtSNF (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_DROOT (1 ESTs); MT_DSTEM2 (1 ESTs); MtRHE (1 ESTs); |
Sequence | TAGATTCTTGCATTGCAAGTGGGAGGAAAAAAAAAATAGTAACATATTGATATTAGTCTA |
EST members of Unigene | DY617587 DY617012 DY616592 CA922272 CA921268 AL388237 AL388236 AL384136 AL376530 AL376529 BE320897 CX526870 CX526603 CX525828 CX523908 BE325247 BF644918 BF643887 EV260710 BE998573 BE998328 BQ139668 BQ138821 BF520553 AW127439 AW775564 AJ845500 AW257293 AW257072 BE204051 BQ156550 BQ154323 CX518851 CX516960 CX532668 CX528748 AA660257 AL367229 AL366590 AL366589 BI266972 EY475682 EY474099 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
EC | 2.5.1.47 4.2.1.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.18520.1.S1_at, Mtr.3883.1.S1_at
|
Corresponding NCBI Gene | 825317 |
Trichome-related Gene from Literature | N/A |