| Detail of EST/Unigene TCMT40246 |
| Acc. | TCMT40246 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S3-3 OS=Arabidopsis thaliana E-value=0; 40S ribosomal protein S3-2 OS=Arabidopsis thaliana E-value=0; 40S ribosomal protein S3-1 OS=Arabidopsis thaliana E-value=0; 40S ribosomal protein S3 OS=Rattus norvegicus E-value=4e-97; 40S ribosomal protein S3 OS=Mus musculus E-value=4e-97; |
| Length | 1249 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER (11 ESTs); MtBA (7 ESTs); MT_Drought (7 ESTs); MT_JAS_ROOR (5 ESTs); MtBC_GLOMUS (5 ESTs); MTFLOW (3 ESTs); MT_NOD_NOLLY (3 ESTs); MT_DLEAF (3 ESTs); MT_GSEED (3 ESTs); MT_INSECT (3 ESTs); MT_JCVI-MT2 (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_KVKC (2 ESTs); MT_DSTEM2 (2 ESTs); MT_PhoLEAF (2 ESTs); MT_JCVI-MT3 (1 ESTs); MT_ECELL (1 ESTs); MT_SIRRA (1 ESTs); MT_NOD_GVN (1 ESTs); MT_SROOT_KV1 (1 ESTs); MTAMP (1 ESTs); MT_CDS (1 ESTs); MT_GESD (1 ESTs); MtRHE (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_SROOT_KV2 (1 ESTs); MT_MGHG (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_IROOT_DSIR (1 ESTs); GLSD (1 ESTs); |
| Sequence | GAAATGATCAAAGCATATGATCAAACACATAACAATTCATCTTCTTCATTCTTTTTCTGT |
| EST members of Unigene | BT051240 DY616896 DY616842 DY616496 CA922676 AL386343 AL382877 AL382876 AL382463 AL382462 CX541807 CX540646 CX538447 AW559349 AW691646 AW690766 BF649454 EV256378 EV255556 BE124910 AJ501460 CA990386 BQ149262 BQ149260 BQ148806 BQ148576 BQ148412 BQ148241 BQ147943 BI271840 BI271248 BI270363 BI270040 BG454604 BG452463 BF636811 AW775180 AI737516 BQ124541 BI263456 BG457372 BI269716 CX530872 CX530199 CX529392 CX529278 CX528886 BF003781 AJ497828 AJ497085 AJ497067 AA661046 BQ750306 BQ255294 AL373110 AL372463 AL372462 AL366823 AL366822 AL365608 AL365607 BE943277 BG451931 BG450405 BE249001 BF636546 BF636541 BF636391 BF633551 BE322637 BE322799 BF640695 EY478034 GE350516 GE345580 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02985 small subunit ribosomal protein S3e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.10371.1.S1_at, Mtr.27080.1.S1_at
|
| Corresponding NCBI Gene | 833518 |
| Trichome-related Gene from Literature | N/A |