| Detail of EST/Unigene TCMT40651 |
| Acc. | TCMT40651 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Protein transport protein Sec61 subunit alpha OS=Dictyostelium discoideum E-value=0; Protein transport protein Sec61 subunit alpha isoform 2 OS=Mus musculus E-value=0; Protein transport protein Sec61 subunit alpha isoform 2 OS=Homo sapiens E-value=0; Protein transport protein Sec61 subunit alpha isoform 2 OS=Bos taurus E-value=0; Protein transport protein Sec61 subunit alpha OS=Harpagifer antarcticus E-value=0; |
| Length | 1882 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_LEAF_PHOMA (6 ESTs); MtBA (6 ESTs); MT_JAS_ROOR (3 ESTs); MT_SEEDROOT_KV3 (3 ESTs); MtBC_GLOMUS (2 ESTs); MtBB_NOD (2 ESTs); MT_DLEAF (2 ESTs); MT_Drought (2 ESTs); MT_Shoots (2 ESTs); MT_DSTEM2 (2 ESTs); MT_SIRRA (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_NOD_GVN (2 ESTs); MT_VILEAF (2 ESTs); MtRHE (1 ESTs); MT_MGHG (1 ESTs); MT_GSEED (1 ESTs); MT_GPOD (1 ESTs); MT_DSIL (1 ESTs); MT_INSECT (1 ESTs); MT_PhoLEAF (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_NOD_GVSN (1 ESTs); MT_TRI (1 ESTs); MT_NOD_ROOT (1 ESTs); MT_ROOTPHOS (1 ESTs); MT_HOGA (1 ESTs); MT_GESD (1 ESTs); MTFLOW (1 ESTs); MTUS_MIXTISSUE (1 ESTs); |
| Sequence | TGATACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
| EST members of Unigene | CF069284 AL381541 AL381540 AL377748 AL377747 CX538529 CX524740 CX523726 AW688838 AW690789 BE999500 BG581060 BG580550 AW686737 AW126098 BI309746 CB891569 BG644809 AW773813 BQ140700 BQ140425 BQ140141 BQ139988 BQ138343 BQ138293 BG452786 BG452579 BI308075 BF518899 BF638830 BQ157134 BI269411 CX522929 CX517302 CX535233 CX533451 CX530092 BG646568 AJ497598 AA660614 AL371700 AL371699 AL368875 AL368874 AL367565 AL367564 BE942100 BG451619 BG451341 BF642466 EY478617 GE349819 GE344778 EX531894 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.5 Type II (general) secretory pathway IISP |
| Probeset |
Msa.1002.1.S1_at, Msa.1545.1.S1_at, Mtr.51378.1.S1_at
|
| Corresponding NCBI Gene | 817986 |
| Trichome-related Gene from Literature | N/A |