Detail of EST/Unigene TCMT41218 |
Acc. | TCMT41218 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S4-2 OS=Arabidopsis thaliana E-value=0; 40S ribosomal protein S4-1 OS=Arabidopsis thaliana E-value=0; 40S ribosomal protein S4-3 OS=Arabidopsis thaliana E-value=0; 40S ribosomal protein S4 OS=Solanum tuberosum E-value=0; 40S ribosomal protein S4 OS=Gossypium hirsutum E-value=0; |
Length | 1283 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD (6 ESTs); MT_FLOSEED_MTY (5 ESTs); MT_DFLOWER (4 ESTs); MtBA (3 ESTs); MT_NOD_NOLLY (2 ESTs); MT_ROOTPHOS (2 ESTs); MT_SROOT_KV1 (2 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_Drought (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_DSTEM2 (2 ESTs); MT_ECELL (2 ESTs); MT_JCVI-MT1 (2 ESTs); GLSD (2 ESTs); MTAMP (1 ESTs); MtRHE (1 ESTs); MT_GESD (1 ESTs); MT_GSEED (1 ESTs); MHRP-root (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_DLEAF (1 ESTs); MT_TRI (1 ESTs); MT_GPOD (1 ESTs); MTPOSE (1 ESTs); MT_NOD_GVN (1 ESTs); MT_PhoLEAF (1 ESTs); MT_UV-B (1 ESTs); MT_SIRRA (1 ESTs); |
Sequence | CGAAAATAAAACAATCTCGTCTGTGCGACGAGATCTTATTATAGTTTCATTTTATTACCA |
EST members of Unigene | DY618308 DY617686 CA920220 CA921125 AL380202 AL380201 AL377897 AL377896 AL374028 AL374027 CX542015 AW560263 AW695711 AW695980 BF649898 BF645494 EV262500 EV256514 DW019361 DW018716 DW017252 DW017059 DW016040 BG583233 DY633225 AW328868 AW328841 AJ500988 BI311219 BE239990 BQ148540 BQ147635 BI270929 BI269973 BG454614 BI309458 AJ499055 CA858384 CA857812 BF638613 BI269499 BF003533 BF003219 AA660631 AL371879 AL371878 AL367653 BF632469 BF632130 GE349652 GE344595 EX526388 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02987 small subunit ribosomal protein S4e |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.34487.1.S1_s_at, Mtr.42851.1.S1_at, Mtr.47687.1.S1_s_at
|
Corresponding NCBI Gene | 830600 |
Trichome-related Gene from Literature | N/A |