Detail of EST/Unigene TCMT42713 |
Acc. | TCMT42713 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 28 kDa heat- and acid-stable phosphoprotein OS=Homo sapiens E-value=1e-12; 28 kDa heat- and acid-stable phosphoprotein OS=Rattus norvegicus E-value=2e-12; 28 kDa heat- and acid-stable phosphoprotein OS=Mus musculus E-value=2e-12; |
Length | 792 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2 (8 ESTs); MT_JCVI-MT3 (4 ESTs); MT_GESD (3 ESTs); MT_DFLOWER (3 ESTs); MtBC_GLOMUS (3 ESTs); MT_DLEAF (3 ESTs); MTAMP (3 ESTs); MT_DROOT (2 ESTs); MtBA (2 ESTs); MT_GSEED (2 ESTs); MT_SROOT_KV0 (2 ESTs); MT_Drought (2 ESTs); MT_ECELL (2 ESTs); MT_PhoLEAF (2 ESTs); MT_VILEAF (2 ESTs); MT_HOGA (1 ESTs); MT_SROOT_KV1 (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MTFLOW (1 ESTs); MtRHE (1 ESTs); MT_DSIL (1 ESTs); MT_Shoots (1 ESTs); GLSD (1 ESTs); MT_INSECT (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_SIRRA (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_ROOTPHOS (1 ESTs); MT_JAS_ROOR (1 ESTs); |
Sequence | GGAAACAAAAAGGGCGAAGTGCATCCCCCATAGTCATTTTCTCTTCAAATTCAATCCAGC |
EST members of Unigene | CF068313 AL388243 AL384494 AL384493 AW687100 BE320787 CX541664 CX536079 CX523884 BF648066 BF645840 EV255796 DW016014 AW329552 AJ503772 AJ503673 AJ501799 CA989867 BI312245 BI309883 BQ149494 BQ148574 BI272979 BG454889 BG452594 BE316959 BF520703 BE203956 BE187581 CA989767 BG456340 BF639014 BI269113 CX519534 CX517054 CX529470 BG647126 BF003485 AJ497371 AA660726 AL367929 AL367928 BE249021 BF636444 BI266389 EY475642 EY475324 EY474767 EY474233 GE352400 GE351467 GE346999 GE346928 GE348078 GE348839 GE343665 GE343439 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.42929.1.S1_at
|
Corresponding NCBI Gene | 834642 |
Trichome-related Gene from Literature | N/A |