| Detail of EST/Unigene TCMT42761 |
| Acc. | TCMT42761 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Ubiquitin-conjugating enzyme E2 2 OS=Medicago sativa E-value=4e-85; Ubiquitin-conjugating enzyme E2 2 OS=Arabidopsis thaliana E-value=4e-85; Ubiquitin-conjugating enzyme E2 2 OS=Triticum aestivum E-value=1e-84; Ubiquitin-conjugating enzyme E2 1 OS=Arabidopsis thaliana E-value=2e-84; Ubiquitin-conjugating enzyme E2 3 OS=Arabidopsis thaliana E-value=8e-76; |
| Length | 795 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD (14 ESTs); MT_JCVI-MT2 (7 ESTs); MtBC_GLOMUS (5 ESTs); MT_PhoLEAF (5 ESTs); MT_GSEED (4 ESTs); MT_DFLOWER (4 ESTs); MT_Drought (4 ESTs); MT_SIRRA (4 ESTs); MT_NOD_GVSN (4 ESTs); MT_VILEAF (4 ESTs); MT_MGHG (3 ESTs); MT_DSIL (3 ESTs); MT_NOD_GVN (2 ESTs); MT_JAS_ROOR (2 ESTs); MT_SROOT_KV1 (2 ESTs); MT_DROOT (2 ESTs); MHRP-root (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_CDS (1 ESTs); MT_NOD_ROOT (1 ESTs); MT_HOGA (1 ESTs); MTAMP (1 ESTs); MT_GESD (1 ESTs); MtBA (1 ESTs); MT_Shoots (1 ESTs); MT_GPOD (1 ESTs); MT_ECELL (1 ESTs); MT_TRI (1 ESTs); MT_FLOSEED_MTY (1 ESTs); |
| Sequence | GGACATAAATGATGTCTCTGATAATAATCACAAAAAGTTAAATTCCGCGTTTTCACATTA |
| EST members of Unigene | BT053453 AL389123 AL389122 AL387967 AL386512 AL386511 AL377986 AL377985 AL377492 AL377491 AL377426 AL377425 AL376503 AL376502 AL374998 AL374997 AL374838 AL374837 AL373832 AL373831 BG448502 BE320666 CX542417 CX542206 CX542009 CX541782 CX524543 BF644929 EV262728 EV261854 DW017583 BE999354 BE999353 BE998884 BE997533 BG583572 BG583117 AW685934 AJ501280 BI312192 BG588983 BE239796 BI273075 BI272623 BI272238 BI271297 CA917344 BF521113 BF518443 BE123937 BI263236 BI263201 BG457553 BG455886 BE323093 BQ156055 BQ153643 BQ153263 BI269290 CX522601 CX522500 CX522176 CX517277 CX534628 CX533121 CB895195 BF003806 BE203357 AL369563 BE942456 BE942387 BE942255 BG450005 BG449985 BF632088 BE248991 GE351559 GE347113 GE349704 GE344790 GE344654 GE346071 GE345250 ES613815 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K10573 ubiquitin-conjugating enzyme E2 A |
| EC | 6.3.2.19 |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase |
| Probeset |
Mtr.37212.1.S1_at
|
| Corresponding NCBI Gene | 814805 |
| Trichome-related Gene from Literature | N/A |