Detail of EST/Unigene TCMT49478 |
Acc. | TCMT49478 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoribulokinase, chloroplastic OS=Mesembryanthemum crystallinum E-value=0; Phosphoribulokinase, chloroplastic OS=Triticum aestivum E-value=0; Phosphoribulokinase, chloroplastic OS=Spinacia oleracea E-value=0; Phosphoribulokinase, chloroplastic OS=Arabidopsis thaliana E-value=0; Phosphoribulokinase, chloroplastic OS=Chlamydomonas reinhardtii E-value=0; |
Length | 1598 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT (18 ESTs); MT_DLEAF (7 ESTs); MT_JCVI-MT1 (6 ESTs); MT_DSLC (6 ESTs); MT_LEAF_PHOMA (4 ESTs); MT_Shoots (4 ESTs); MT_DSTEM2 (4 ESTs); MT_DSIL (3 ESTs); MT_PhoLEAF (3 ESTs); MT_JCVI-MT2 (3 ESTs); MT_DFLOWER (2 ESTs); MT_CDS (2 ESTs); MT_Drought (2 ESTs); MT_GPOD (1 ESTs); MT_GSEED (1 ESTs); MT_VILEAF (1 ESTs); MTFLOW (1 ESTs); MHRP-root (1 ESTs); |
Sequence | AATATATGTCCCAAATAATCCTCTATCCAACTTAAACTCACTTCTTCTTCAAAAAATAAA |
EST members of Unigene | BT052257 BT052065 CX540199 CX527150 CX525560 CX525533 CX525221 AW693292 BE325792 AW692286 AW689957 EV259451 EV259154 EV257906 EV257388 EV257104 EV256869 BF006313 BF006290 BF005735 BF005480 AW127700 AW127629 BE239626 BI273316 BI272470 BQ140747 BQ140228 BQ139675 BQ138114 BE317763 BE317552 AW683563 BE249577 BE318016 BE315675 BE318387 BI309636 BF520580 BF520089 BE124314 BG456037 BE323818 BF638758 CX522707 AJ496895 BG450020 BF633192 BI267905 BI267665 BI267512 BI267290 BI266569 BI266162 BI265837 BI265416 BG449459 BE322667 BE321765 BE321818 BE322161 BE322174 BF642611 BF640943 BF640806 BF639825 GE351025 GE346193 GE346192 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00876 uridine kinase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K00876 uridine kinase |
EC | 2.7.1.48 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.3176.1.S1_at, Mtr.10464.1.S1_at
|
Corresponding NCBI Gene | 840098 |
Trichome-related Gene from Literature | N/A |