| Detail of EST/Unigene TCMT40105 |
| Acc. | TCMT40105 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | V-type proton ATPase 16 kDa proteolipid subunit OS=Vigna radiata var. radiata E-value=7e-56; V-type proton ATPase 16 kDa proteolipid subunit c5 OS=Arabidopsis thaliana E-value=7e-56; V-type proton ATPase 16 kDa proteolipid subunit c3 OS=Arabidopsis thaliana E-value=7e-56; V-type proton ATPase 16 kDa proteolipid subunit c1 OS=Arabidopsis thaliana E-value=7e-56; V-type proton ATPase 16 kDa proteolipid subunit OS=Gossypium hirsutum E-value=3e-55; |
| Length | 958 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2 (8 ESTs); MT_VILEAF (7 ESTs); MT_DSTEM2 (6 ESTs); MT_DSIL (6 ESTs); MtBB_NOD (5 ESTs); MT_SROOT_KV1 (5 ESTs); MT_PhoLEAF (3 ESTs); MT_NOD_GVN (3 ESTs); MT_GESD (3 ESTs); MT_DLEAF (3 ESTs); MT_TRI (2 ESTs); MT_DSLC (2 ESTs); MTAMP (2 ESTs); MT_JAS_ROOR (2 ESTs); MHRP-root (2 ESTs); MtBA (2 ESTs); MT_SEEDROOT_KV3 (2 ESTs); MT_DFLOWER (2 ESTs); MT_INSECT (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_JCVI-MT3 (2 ESTs); MT_NOD_GVSN (1 ESTs); MT_BML (1 ESTs); MT_SIRRA (1 ESTs); MtBC_GLOMUS (1 ESTs); MT_GSEED (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_MGHG (1 ESTs); MT_Drought (1 ESTs); MT_ECELL (1 ESTs); MT_GPOD (1 ESTs); MT_FLOSEED_MTY (1 ESTs); |
| Sequence | GGAACCATCAACCATCATCATCTTCCTCTACCACAACACAACAGAGATCGAAACTTCTCT |
| EST members of Unigene | AL387064 AL376851 AL376087 AL376086 AL374026 AL374025 CX536313 AW560208 AW697176 AW692976 AW694016 AW693697 AW690133 AW689836 BQ135866 EV256932 EV256033 DW015119 BE998704 BG583615 BG580785 AW980530 BF005780 BF005732 AJ503661 AJ502698 CA990137 BI312188 BI311565 BG588781 BG588511 BG587826 AW736396 BI272994 BI270850 BG452217 BE319017 BE317859 CA917374 BF520124 BF519848 BF518483 BF518462 BE124121 AW776035 BI263537 BI263332 BF638549 BQ155845 CX522542 CX521604 CX521355 CX520714 CX519628 CX518691 CX516724 CX529911 CX529855 BF003360 BE203451 BE203450 BE202832 BE202806 AL372853 AL367794 BE942856 BF635761 BG449150 BF639891 EY478254 EY476204 GE351577 GE351527 GE352290 GE347078 GE347956 GE349263 GE347139 GE344157 GD185757 EX527171 ES611601 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00190 Oxidative phosphorylation > K02155 V-type H+-transporting ATPase 16kDa proteolipid subunit |
| EC | 3.6.3.14 |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase |
| Probeset |
Mtr.20104.1.S1_at
|
| Corresponding NCBI Gene | 829624 |
| Trichome-related Gene from Literature | N/A |